<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "https://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd">
<article xmlns:xlink="http://www.w3.org/1999/xlink" 
         xmlns:mml="http://www.w3.org/1998/Math/MathML" 
         xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance"
         xmlns:ali="http://www.niso.org/schemas/ali/1.0/"
         article-type="research-article" 
         dtd-version="1.2" 
         xml:lang="en">
  <?properties manuscript?>
  <?origin nihpa?>
  <front>
    <journal-meta>
      <journal-id journal-id-type="publisher-id">abc</journal-id>
      <journal-title-group>
        <journal-title>Archives of Breast Cancer</journal-title>
      </journal-title-group>
      <issn pub-type="ppub">2383-0425</issn>
      <issn pub-type="epub">2383-0433</issn>
      <publisher>
        <publisher-name>Farname Inc.</publisher-name>
      </publisher>
    </journal-meta>
    <article-meta>
      <article-id pub-id-type="doi">10.32768/abc.202512131-38</article-id>
      <article-id pub-id-type="manuscript">990</article-id>
      <article-version vocab="JAV" vocab-identifier="http://www.niso.org/publications/rp/RP-8-2008.pdf" 
        article-version-type="VoR" vocab-term="Version of Record">version-of-record</article-version>
      <article-categories>
        <subj-group subj-group-type="heading">
          <subject>Original Article</subject>
        </subj-group>
      </article-categories>
      <title-group>
        <article-title>The Role of Long Non-coding RNA (NKILA and LINC00993) as Tumor Biomarkers in Breast Cancer</article-title>
      </title-group>
      <contrib-group>
        <contrib contrib-type="author" corresp="yes">
          <name>
            <surname>Mohamed</surname>
            <given-names>Randa H.</given-names>
          </name>
          <email>randahussiny@yahoo.com</email>
          <xref ref-type="aff" rid="aff1">a</xref>
          <xref ref-type="corresp" rid="cor1">*</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Alkilany</surname>
            <given-names>Mohamed M.</given-names>
          </name>
          <xref ref-type="aff" rid="aff2">b</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>El-feky</surname>
            <given-names>Hoda K.</given-names>
          </name>
          <xref ref-type="aff" rid="aff1">a</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Abd-elmoneim</surname>
            <given-names>Bassel T.</given-names>
          </name>
          <xref ref-type="aff" rid="aff3">c</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Abd-Elmageed</surname>
            <given-names>Amal F</given-names>
          </name>
          <xref ref-type="aff" rid="aff1">a</xref>
        </contrib>
      </contrib-group>
      <aff id="aff1">
        <label>a</label>
        <institution>Medical Biochemistry Department, Faculty of Medicine, Zagazig University</institution>, <city>Zagazig</city>, <country country="EG">Egypt</country>
      </aff>
      <aff id="aff2">
        <label>b</label>
        <institution>General Surgery Department, Faculty of Medicine, Zagazig University</institution>, <city>Zagazig</city>, <country country="EG">Egypt</country>
      </aff>
      <aff id="aff3">
        <label>c</label>
        <institution>General Practitioner, Faculty of Medicine, Ain Shams University</institution>, <city>Cairo</city>, <country country="EG">Egypt</country>
      </aff>
      <author-notes>
        <corresp id="cor1">
          <label>*</label>
          Address for correspondence: Randa H. Mohamed, 
          <institution>Medical Biochemistry Department, Faculty of Medicine, Zagazig University</institution>, 
          <city>Zagazig</city>, <country>Egypt</country>. 
          E-mail: <email>randahussiny@yahoo.com</email>
        </corresp>
        <fn fn-type="coi-statement">
          <p>The authors declare that there is no conflict of interest regarding the publication of this article.</p>
        </fn>
      </author-notes>
      <pub-date date-type="pub" publication-format="print" iso-8601-date="2025">
        <year>2025</year>
      </pub-date>
      <pub-date date-type="pub" publication-format="electronic" iso-8601-date="2025">
        <year>2025</year>
      </pub-date>
      <volume>12</volume>
      <issue>1</issue>
      <fpage>31</fpage>
      <lpage>37</lpage>
      <history>
        <date date-type="received" iso-8601-date="2024-07-14">
          <day>14</day>
          <month>07</month>
          <year>2024</year>
        </date>
        <date date-type="rev-recd" iso-8601-date="2024-10-16">
          <day>16</day>
          <month>10</month>
          <year>2024</year>
        </date>
        <date date-type="accepted" iso-8601-date="2024-10-29">
          <day>29</day>
          <month>10</month>
          <year>2024</year>
        </date>
      </history>
      <permissions>
        <copyright-statement>Copyright &#x00A9; 2025 Archives of Breast Cancer</copyright-statement>
        <copyright-year>2025</copyright-year>
        <copyright-holder>Archives of Breast Cancer</copyright-holder>
        <license license-type="open-access">
          <license-p>
            This is an open-access article distributed under the terms of the Creative Commons Attribution-Non-Commercial 4.0 International License 
            (<ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by-nc/4.0/" xlink:title="Creative Commons Attribution-NonCommercial 4.0 International License">Creative Commons Attribution-NonCommercial 4.0 International License</ext-link>), 
            which permits copy and redistribution of the material in any medium or format or adapt, remix, transform, and build upon the material for any purpose, except for commercial purposes.
          </license-p>
          <ali:license_ref>https://creativecommons.org/licenses/by-nc/4.0/</ali:license_ref>
        </license>        
      </permissions>
      <self-uri xlink:href="https://www.archbreastcancer.com/index.php/abc/article/view/990" content-type="pdf" xlink:title="PDF Full Text"/>
      <abstract>
        <sec id="S_ABS_BKG">
          <title>Background</title>
          <p id="P1">Long non-coding RNAs (NKILA and LINC00993) are downregulated in breast cancer (BC) and can have potential use as a novel tumor biomarker. The aim of this work was to investigate the LncRNAs (NKILA and LINC00993) and cytokines (NF-&#x03BA;B and CXCL-1) as potential biomarkers in BC.</p>
        </sec>
        <sec id="S_ABS_METH">
          <title>Methods</title>
          <p id="P2">This cross-sectional study included sixty-four pairs of surgically resected human breast cancer tissues and adjacent breast tissues. Expressions of LncRNAs (NKILA, LINC00993) and (NF-&#x03BA;B, CXCL1) cytokines were detected using real-time quantitative polymerase chain reaction (qPCR) analysis,</p>
        </sec>
        <sec id="S_ABS_RES">
          <title>Results</title>
          <p id="P3">There was a significant decrease in LncRNAs (NKILA, LINC00993) levels in tumor tissue compared to normal tissue (P&lt;0.001). Also, there was a significant increase in NF-&#x03BA;B and CXCL1 levels in tumor tissue compared to normal tissue (P&lt;0.001). ROC curve analysis indicated that the LncRNAs (NKILA, LINC00993) expression levels could be considered a promising marker for the diagnosis of breast cancer patients with a sensitivity of 90.6%, 92.2%, respectively. Also, cytokines (NF-&#x03BA;B and CXCL-1) expression levels could be considered a promising marker for the diagnosis of breast cancer patients with a sensitivity and specificity of 87.5%, and 89.1% respectively.</p>
        </sec>
        <sec id="S_ABS_CONCL">
          <title>Conclusion</title>
          <p id="P4">These findings suggest that LncRNAs (NKILA, LINC00993) and cytokines (NF-&#x03BA;B and CXCL-1) can be used as novel biomarkers for breast cancer.</p>
        </sec>
      </abstract>
      <kwd-group>
        <title>Keywords</title>
        <kwd>biomarker</kwd>
        <kwd>NKILA</kwd>
        <kwd>LINC00993</kwd>
        <kwd>breast cancer</kwd>
      </kwd-group>
      <funding-group>
        <funding-statement>This research received no specific grant from any funding agency in the public, commercial, or not-for-profit sectors.</funding-statement>
      </funding-group>
    </article-meta>
  </front>
  <body>
    <sec sec-type="intro" id="S1">
      <title>Introduction</title>
      <p id="P5">Breast cancer has become one of the most common malignant tumor, and the incidence rate is increasing every year.<xref rid="R1" ref-type="bibr"><sup>1</sup></xref> The incidence is significantly higher in developed countries than in developing countries.<xref rid="R2" ref-type="bibr"><sup>2</sup></xref> In Egypt, BC is estimated to be the most common cancer among females (37.7%) and the leading cause of death (29.1%). The mechanism of breast carcinogenesis is still not fully understood.<xref rid="R3" ref-type="bibr"><sup>3</sup></xref> Early diagnosis of cancer remains a challenge for clinicians; it is an important goal to reduce treatment-associated morbidity and mortality and to reach maximal long-term survival.<xref rid="R4" ref-type="bibr"><sup>4</sup></xref></p>
      <p id="P6">Long non-coding RNAs (lncRNAs), which are RNA transcripts with a length greater than 200 nucleotides, have exhibited oncogenic or tumour suppressive roles in the pathogenesis of breast cancer.<xref rid="R5" ref-type="bibr"><sup>5</sup></xref>,<xref rid="R6" ref-type="bibr"><sup>6</sup></xref> NF-&#x03BA;B Interacting LncRNA (NKILA) can be involved in the pathogenesis of a wide spectrum of human disorders. Numerous studies in hepatocellular carcinoma, breast cancer, melanoma, glioma, and other types of neoplasms have indicated the role of NKILA in the blockage of tumor growth and inhibition of metastasis.<xref rid="R7" ref-type="bibr"><sup>7</sup></xref></p>
      <p id="P7">LINC00993 (Long intergenic non-protein coding RNA 00993) is located on chromosome 10, considerably downregulated in Triple Negative Breast Cancer (TNBC), and associated with Estrogen Receptor (ER) expression.<xref rid="R8" ref-type="bibr"><sup>8</sup></xref> To the best of our knowledge, the precise relationship between NKILA and LINC00993 and BC remains poorly understood.</p>
      <p id="P8">NKILA has inhibitory roles on NF-&#x03BA;B which belongs to a family of transcription factors that regulate the expression of several molecules and cytokines as C-X-C motif chemokine ligand 1 (CXCL1) participating in various crucial physiological reactions including immune responses, cell proliferation, and differentiation, as well as cell death.<xref rid="R9" ref-type="bibr"><sup>9</sup></xref></p>
      <p id="P9">This work aims to investigate the lncRNA (NKILA and LINC00993) and cytokines (NF-&#x03BA;B and CXCL-1) as potential biomarkers in BC.</p>
    </sec>
    <sec sec-type="methods" id="S2">
      <title>Methods</title>
      <sec id="S2_1">
        <title>Study design and participants</title>
        <p id="P10">In this cross-sectional design study, we included sixty-four patients with primary breast cancer who attended the General Surgery Department, at Zagazig University Hospital for partial/total mastectomy. Tumor, nodes, and metastasis (TNM) staging was performed according to the 7th edition of the UICC<xref rid="R10" ref-type="bibr"><sup>10</sup></xref>.</p>
        <p id="P11">Sixty-four tissue samples obtained from tumor tissues represented group A, and sixty-four tissue samples from their normal adjacent tissues served as the control group B.</p>
        <p id="P12">This study was approved by the Ethical Committee of the Faculty of Medicine, Zagazig University, and following the Helsinki Declaration of 2013. All of the patients were subjected to full history taking and a complete general examination. The diagnosis of all patients was pathologically confirmed after positive mammography. Informed written consent from each participant was taken before participation in the research.</p>
      </sec>
      <sec id="S2_2">
        <title>Inclusion criteria</title>
        <p id="P13">histopathological confirmation of the diagnosis of breast cancer, adequate hepatic, renal, cardiac and respiratory functions.</p>
      </sec>
      <sec id="S2_3">
        <title>Exclusion criteria</title>
        <p id="P14">Male patients, patients with tumors other than breast cancer, those with tumors of unknown origin, patients with histopathological diagnosis other than breast carcinoma, and those who refused to give consent and cooperate.</p>
      </sec>
      <sec id="S2_4">
        <title>Tissue sampling and homogenization</title>
        <p id="P15">The sixty-four pairs of surgically resected breast tissues were immediately frozen and kept at &#x2212;80 &#x00B0;C. Homogenization of tissue samples was performed using a power homogenizer. Tissue samples were homogenized in about 700&#x03BC;l of GENEzol&#x2122; Reagent per 50 mg of tissue using mortar and pestle with liquid nitrogen.</p>
      </sec>
      <sec id="S2_5">
        <title>RNA extraction, and reverse-transcription</title>
        <p id="P16">To quantify gene expression, first RNA was isolated from tissue homogenate using the TriRNA Pure Kit, (Geneaid, China). Complementary DNA (cDNA) was reverse transcribed using a Maxime RT PreMix kit. The cDNA was reverse transcribed in a 20 &#x03BC;L mixture containing 10 &#x03BC;L of total RNA and 10 &#x03BC;L of distilled water. The mixture was incubated at 75&#x00BA;C for 5 min, then 60&#x00BA;C for 60 min, 95 &#x00BA;C for 5 min (RTase inactivation), and ice bath for 5 min.</p>
      </sec>
      <sec id="S2_6">
        <title>Quantification of gene expression</title>
        <p id="P17">The real-time PCR reaction was performed in a total volume of 20 &#x03BC;L containing 5 &#x03BC;L of the cDNA, 10 pmol/&#x03BC;L of each primer (0.5 &#x03BC;L each), 10 &#x03BC;L of TopReal SYBER Green master mix (Enzynomics, Korea), and 8 &#x03BC;L PCR-grade water. The oligonucleotide primers were synthesized by Sangon Biotech (Beijing, China). The primer sequences used for qRT-PCR are shown in Table 1. The real-time RT-PCR was performed in a Rotor-Gene Q 2 plex Real-Time PCR System (Qiagen, Germany). The PCR cycling conditions included an initial denaturation at 95&#x00B0;C for 12 minutes followed by 40 cycles of denaturation at 95&#x00B0;C for 20 seconds, annealing at 60&#x00B0;C for 30 seconds, and extension at 72&#x00B0;C for 30 seconds. The relative expression was calculated with the 2-&#x0394;&#x0394;ct method.<xref rid="R11" ref-type="bibr"><sup>11</sup></xref></p>
        <table-wrap id="T1" position="float">
          <label>Table 1</label>
          <caption>
            <p>Primer Sequences Used for Quantitative Real-Time Polymerase Chain Reaction</p>
          </caption>
          <table>
            <thead>
              <tr>
                <th>Name</th>
                <th>Forward Primer</th>
                <th>Reverse Primer</th>
              </tr>
            </thead>
            <tbody>
              <tr>
                <td>NKILA</td>
                <td>CTTTGGAGGAGTCCAAGCGT</td>
                <td>GTGGCTCCAAGAGTGAGCTT</td>
              </tr>
              <tr>
                <td>LINC00993</td>
                <td>GGCCAAGCACATCTGCAAAA</td>
                <td>CCACTGCTTTTCCCAGGACT</td>
              </tr>
              <tr>
                <td>NF-KB</td>
                <td>GGGGATGGTGAGAAGGTTGG</td>
                <td>GCAGTGCCATCTGTGGTTGA</td>
              </tr>
              <tr>
                <td>CXCL1</td>
                <td>TGGCTTAGAACAAAGGGGCT</td>
                <td>AAGGTAGCCCTTGTTTCCCC</td>
              </tr>
              <tr>
                <td>Gapdh</td>
                <td>CCATGGGGAAGGTGAAGGTC</td>
                <td>CTTCCCGTTCTCAGCCATGT</td>
              </tr>
            </tbody>
          </table>
          <table-wrap-foot>
            <fn>
              <p>NKILA, NF-kB interacting long noncoding RNA; LINC00993, Long intergenic non-protein coding RNA 00993; NF-KB, Nuclear Factor kappa &#x2013;light- chain- enhancer of activated B cells; CXCL1, C-X-C motif chemokine ligand 1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.</p>
            </fn>
          </table-wrap-foot>
        </table-wrap>
      </sec>
      <sec id="S2_7">
        <title>Statistical analysis</title>
        <p id="P18">Data were analyzed using SPSS version 22, and expressed as mean &#x00B1; SD for the quantitative parametric variable, and the median for the non-parametric one, with categorical variables expressed as frequency and percentage. Paired Student&#x2019;s t-test was used to compare the two groups in case of normally distributed data, and Mann-Whitney was used to compare them regarding non-normally distributed data when appropriate. We performed Spearman's correlation coefficient test on LINC00993, NF-&#x03BA;B, and NKILA to see if NKILA and LINC00993 influence cancer-related pathways or mechanisms in BC. A P-value of &lt; 0.05 was considered statistically significant. The analysis was based on the accuracy of the identified LncRNA (NKILA and LINC00993) and cytokines (NF-&#x03BA;B and CXCL-1) as a potential biomarker in breast cancer using receiver operator characteristic (ROC) curves as the area under the curve (AUC) value, and sensitivity and specificity.</p>
      </sec>
    </sec>
    <sec sec-type="results" id="S3">
      <title>Results</title>
      <p id="P19">The age of the studied participants ranged from 40 to 66 years with a mean of 52.75 years. Overall, 57.8% of the patients had a positive family history.</p>
      <p id="P20">There was a significant decrease in LncRNA (NKILA and LINC00993) in tumour tissue compared to normal tissue (P&lt;0.001). There was a significant increase in NF-&#x03BA;B and CXCL-1 in tumor tissues compared to normal tissue (P&lt;0.001) (Table 2).</p>
      <table-wrap id="T2" position="float">
        <label>Table 2</label>
        <caption>
          <p>Expression Levels of Long Noncoding RNA (NKILA and LINC00993), NF-&#x03BA;B, and CXCL-1 Among Patients With Primary Breast Cancer</p>
        </caption>
        <table>
          <thead>
            <tr>
              <th>Variable</th>
              <th>Tumor tissue (n=64)</th>
              <th>Normal tissue (n=64)</th>
              <th>P</th>
            </tr>
          </thead>
          <tbody>
            <tr>
              <td>NKILA</td>
              <td>0.32&#x00B1;0.22</td>
              <td>0.97&#x00B1;0.22</td>
              <td>&lt;0.001</td>
            </tr>
            <tr>
              <td>LINC00993</td>
              <td>0.51&#x00B1;0.19</td>
              <td>0.97&#x00B1;0.14</td>
              <td>&lt;0.001</td>
            </tr>
            <tr>
              <td>NF-KB</td>
              <td>5.47&#x00B1;2.38</td>
              <td>1.22&#x00B1;0.66</td>
              <td>&lt;0.001</td>
            </tr>
            <tr>
              <td>CXCL-1</td>
              <td>5.43&#x00B1;2.61</td>
              <td>1.25&#x00B1;0.69</td>
              <td>&lt;0.001</td>
            </tr>
          </tbody>
        </table>
        <table-wrap-foot>
          <fn>
            <p>NKILA, NF-KB interacting long noncoding RNA; LINC00993, Long intergenic non-protein coding RNA 00993; NF-KB Nuclear Factor kappa &#x2013;light- chain- enhancer of activated B cells; CXCL1, C-X-C motif chemokine ligand 1.</p>
          </fn>
        </table-wrap-foot>
      </table-wrap>
      <p id="P21">There was a significant decrease in NKILA in cases with positive family history, Grade 3, negative ER and PR, and N3 compared to other cases (P&lt;0.001). Also, there was a significant decrease in LINC00993 in cases with Grade 3 and N3 compared to other cases (P&lt;0.001). There was a significant increase in NF-&#x03BA;B in cases with negative Er, PR, and N3 compared to other cases. Also, there was a significant increase in CXCL-1 in cases with tumour size &gt;5, ILC type, grade 3, and T3 or 4 compared to other cases (Table 3). There was a positive correlation between LINC00993, NF-&#x03BA;B, and NKILA (Table 4).</p>
      <table-wrap id="T3" position="float">
        <label>Table 3</label>
        <caption>
          <p>Relation Between Family History, Clinicopathological Parameters, and Biomarkers Among Patients With Primary Breast Cancer</p>
        </caption>
        <table>
          <thead>
            <tr>
              <th rowspan="2" style="vertical-align:middle;"> </th>
              <th rowspan="2" style="vertical-align:middle;">No</th>
              <th rowspan="2" style="vertical-align:middle;">%</th>
              <th colspan="2">NKILA</th>
              <th colspan="2">LINC00993</th>
              <th colspan="2">NF-&#x03BA;B</th>
              <th colspan="2">CXCL-1</th>
            </tr>
            <tr>
              <th> </th>
              <th>P</th>
              <th> </th>
              <th>P</th>
              <th> </th>
              <th>p</th>
              <th> </th>
              <th>P</th>
            </tr>
          </thead>
          <tbody>
            <tr>
              <td>Family history</td>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
            </tr>
            <tr>
              <td>-ve</td>
              <td>27</td>
              <td>42.2</td>
              <td>0.42</td>
              <td rowspan="2" style="vertical-align:middle;">&lt;0.001</td>
              <td>0.52</td>
              <td rowspan="2" style="vertical-align:middle;">0.19</td>
              <td>5.6</td>
              <td rowspan="2" style="vertical-align:middle;">0.96</td>
              <td>5.82</td>
              <td rowspan="2" style="vertical-align:middle;">0.59</td>
            </tr>
            <tr>
              <td>+ve</td>
              <td>37</td>
              <td>57.8</td>
              <td>0.22**</td>
              <td>0.47</td>
              <td>5.43</td>
              <td>4.86</td>
            </tr>
            <tr>
              <td>Tumor size</td>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
            </tr>
            <tr>
              <td>&lt; 5</td>
              <td>39</td>
              <td>60.9</td>
              <td>0.28</td>
              <td rowspan="2" style="vertical-align:middle;">0.12</td>
              <td>0.49</td>
              <td rowspan="2" style="vertical-align:middle;">0.71</td>
              <td>5.54</td>
              <td rowspan="2" style="vertical-align:middle;">0.44</td>
              <td>4.17</td>
              <td rowspan="2" style="vertical-align:middle;">0.003</td>
            </tr>
            <tr>
              <td>&#x2265; 5</td>
              <td>25</td>
              <td>39.1</td>
              <td>0.22</td>
              <td>0.47</td>
              <td>5.60</td>
              <td>6.59*</td>
            </tr>
            <tr>
              <td>Tumor type</td>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
            </tr>
            <tr>
              <td>IDC</td>
              <td>55</td>
              <td>85.9</td>
              <td>0.28</td>
              <td rowspan="2" style="vertical-align:middle;">0.002</td>
              <td>0.50</td>
              <td rowspan="2" style="vertical-align:middle;">0.01</td>
              <td>5.60</td>
              <td rowspan="2" style="vertical-align:middle;">0.38</td>
              <td>4.86</td>
              <td rowspan="2" style="vertical-align:middle;">0.003</td>
            </tr>
            <tr>
              <td>ILC</td>
              <td>9</td>
              <td>14.1</td>
              <td>0.12*</td>
              <td>0.34*</td>
              <td>4.69</td>
              <td>7.42*</td>
            </tr>
            <tr>
              <td>Tumor grade</td>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
            </tr>
            <tr>
              <td>1 or 2</td>
              <td>47</td>
              <td>73.4</td>
              <td>0.30</td>
              <td rowspan="2" style="vertical-align:middle;">&lt;0.001</td>
              <td>0.51</td>
              <td rowspan="2" style="vertical-align:middle;">&lt;0.001</td>
              <td>5.78</td>
              <td rowspan="2" style="vertical-align:middle;">0.39</td>
              <td>4.86</td>
              <td rowspan="2" style="vertical-align:middle;">0.008</td>
            </tr>
            <tr>
              <td>3</td>
              <td>17</td>
              <td>26.6</td>
              <td>0.12**</td>
              <td>0.34**</td>
              <td>4.69</td>
              <td>6.73*</td>
            </tr>
            <tr>
              <td>T</td>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
            </tr>
            <tr>
              <td>T2</td>
              <td>37</td>
              <td>57.8</td>
              <td>0.28</td>
              <td rowspan="2" style="vertical-align:middle;">0.45</td>
              <td>0.49</td>
              <td rowspan="2" style="vertical-align:middle;">0.90</td>
              <td>5.54</td>
              <td rowspan="2" style="vertical-align:middle;">0.67</td>
              <td>4.57</td>
              <td rowspan="2" style="vertical-align:middle;">0.03</td>
            </tr>
            <tr>
              <td>T3 or 4</td>
              <td>27</td>
              <td>42.2</td>
              <td>0.22</td>
              <td>0.47</td>
              <td>5.60</td>
              <td>6.59*</td>
            </tr>
            <tr>
              <td>ER, PR</td>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
            </tr>
            <tr>
              <td>-ve</td>
              <td>53</td>
              <td>82.8</td>
              <td>0.23</td>
              <td rowspan="2" style="vertical-align:middle;">&lt;0.001</td>
              <td>0.49</td>
              <td rowspan="2" style="vertical-align:middle;">0.64</td>
              <td>5.82</td>
              <td rowspan="2" style="vertical-align:middle;">0.04</td>
              <td>5.03</td>
              <td rowspan="2" style="vertical-align:middle;">0.73</td>
            </tr>
            <tr>
              <td>+ve</td>
              <td>11</td>
              <td>17.2</td>
              <td>0.75**</td>
              <td>0.41</td>
              <td>5.43*</td>
              <td>5.82</td>
            </tr>
            <tr>
              <td>N</td>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
              <td/>
            </tr>
            <tr>
              <td>N1</td>
              <td>9</td>
              <td>14.1</td>
              <td>0.79</td>
              <td rowspan="3" style="vertical-align:middle;">&lt;0.001</td>
              <td>0.52</td>
              <td rowspan="3" style="vertical-align:middle;">&lt;0.001</td>
              <td>4.2</td>
              <td rowspan="3" style="vertical-align:middle;">0.03</td>
              <td>5.82</td>
              <td rowspan="3" style="vertical-align:middle;">0.06</td>
            </tr>
            <tr>
              <td>N2</td>
              <td>35</td>
              <td>54.7</td>
              <td>0.28</td>
              <td>0.36</td>
              <td>5.54</td>
              <td>4.57</td>
            </tr>
            <tr>
              <td>N3</td>
              <td>20</td>
              <td>31.3</td>
              <td>0.12**</td>
              <td>0.34</td>
              <td>6.54*</td>
              <td>6.73</td>
            </tr>
          </tbody>
        </table>
        <table-wrap-foot>
          <fn>
            <p>MW: Mann Whitney; KW: Kruskal Wallis test</p>
            <p>*: Significant (P&lt;0.05)</p>
            <p>**: highly significant (P &lt;0.001)</p>
            <p>NKILA, NF-KB interacting long noncoding RNA; LINC00993, Long intergenic non-protein coding RNA 00993; NF-KB, Nuclear Factor kappa –light- chain- enhancer of activated B cells; CXCL1, C-X-C motif chemokine ligand 1. Tumors we regraded according to the modified Bloom–Richardson system; T size of the tumor, T2 (2–5 cm), T3 (&gt;5 cm), T4 (infiltration of the chest wall/skin), N regional lymph node involvement, N1 cancer has spread to one to three axillary lymph node(s), and/or tiny amounts of cancer are found in internal mammary lymph nodes on lymph node biopsy, N2 cancer has spread to four to nine axillary lymph nodes, or cancer has enlarged the internal mammary lymph nodes, N3 cancer has spread to axillary lymph nodes, the internal mammary lymph nodes and/or infraclavicular and supraclavicular lymph nodes; ER and PR, estrogen receptor and progesterone receptor.</p>
          </fn>
        </table-wrap-foot>
      </table-wrap>
      <table-wrap id="T4" position="float">
        <label>Table 4</label>
        <caption>
          <p>Correlation Between Long Noncoding RNA, NF-&#x03BA;B, and CXCL-1 Among Patients With Primary Breast Cancer</p>
        </caption>
        <table>
          <thead>
            <tr>
              <th> </th>
              <th>NKILA r</th>
              <th>LINC00993</th>
              <th>NF-KB</th>
            </tr>
          </thead>
          <tbody>
            <tr>
              <td>LINC00993</td>
              <td>0.63**</td>
              <td> </td>
              <td> </td>
            </tr>
            <tr>
              <td>NF-KB</td>
              <td>-0.29*</td>
              <td>0.04</td>
              <td> </td>
            </tr>
            <tr>
              <td>CXCL-1</td>
              <td>-0.10</td>
              <td>-0.23</td>
              <td>0.10</td>
            </tr>
          </tbody>
        </table>
        <table-wrap-foot>
          <fn>
            <p>r: Spearman's correlation coefficient.</p>
            <p>*: Significant (P&lt;0.05) **: highly significant (P &lt;0.001)</p>
            <p>NKILA, NF-KB interacting long noncoding RNA; LINC00993, Long intergenic non-protein coding RNA 00993; NF-KB, Nuclear Factor kappa –light- chain- enhancer of activated B cells; CXCL1, C-X-C motif chemokine ligand 1.</p>
          </fn>
        </table-wrap-foot>
      </table-wrap>
      <sec id="S3_1">
        <title>Long non-coding RNA (NKILA, LINC00993) and cytokines (NF-&#x03BA;B, CXCL-1) as potential biomarkers in breast cancer</title>
        <p id="P22">The sensitivity and specificity of the studied parameters&#x2019; expression levels as biomarkers in BC were assessed in the breast cancer tissues using ROC curve analysis. ROC curve analysis indicated that long non-coding RNA (NKILA, LINC00993) expression levels could be considered a diagnostic parameter for BC with a sensitivity of 90.6%, 92.2%, respectively and specificity of 85.9 % and 84.4 %, respectively. Cytokines (NF-&#x03BA;B, CXCL-1) expression levels could be considered a diagnostic parameter for breast cancer with a sensitivity (87.5%, 89.1% respectively) and specificity of 89.1 %, 87.5 % respectively (Table 5), (Figure 1).</p>
        <fig id="F1"> <label>Figure 1</label>
          <caption>
            <p>Receiver Operating Characteristic Curves for Validity of Long Noncoding RNAs and Cytokines in the Diagnosis of Breast Cancer. A, Long noncoding RNAs (NKILA and LINC00993). B, Cytokines (NF-&#x03BA;B and CXCL-1). CXCL-1 indicates C-X-C motif chemokine ligand 1; LINC00993, long intergenic non&#x2013;protein coding RNA 00993; NF-&#x03BA;B, nuclear factor &#x03BA;-light-chain-enhancer of activated B cells; NKILA, NF-&#x03BA;B interacting long noncoding RNA.</p>
          </caption>
          <graphic xlink:href="2383-0433-12-01-031-g001.jpg" position="float" orientation="portrait">
            <alt-text>Figure 1a. Roc curve for validity of LncRNAs (NKILA and LINC00993)</alt-text>
          </graphic>
          </fig>
        <table-wrap id="T5" position="float">
          <label>Table 5</label>
          <caption>
            <p>Validity of Biomarkers in the Diagnosis of Breast Cancer Among Patients</p>
          </caption>
          <table>
            <thead>
              <tr>
                <th> </th>
                <th>Cut off</th>
                <th>AUC(CI 95%)</th>
                <th>Sensitivity</th>
                <th>Specificity</th>
                <th>PPV</th>
                <th>NPV</th>
                <th>Accuracy</th>
                <th>p</th>
              </tr>
            </thead>
            <tbody>
              <tr>
                <td>NKILA</td>
                <td>&lt;0.75</td>
                <td>0.97(0.94-1)</td>
                <td>90.6%</td>
                <td>85.9%</td>
                <td>86.6%</td>
                <td>90.1%</td>
                <td>87.5%</td>
                <td>&lt;0.001</td>
              </tr>
              <tr>
                <td>LINC00993</td>
                <td>&lt;0.88</td>
                <td>0.97(0.95-0.99)</td>
                <td>92.2%</td>
                <td>84.4%</td>
                <td>85.5%</td>
                <td>91.5%</td>
                <td>88.3%</td>
                <td>&lt;0.001</td>
              </tr>
              <tr>
                <td>NF-KB</td>
                <td>&gt;2.05</td>
                <td>0.95(0.91-0.99)</td>
                <td>87.5%</td>
                <td>89.1%</td>
                <td>88.9%</td>
                <td>87.7%</td>
                <td>85.9%</td>
                <td>&lt;0.001</td>
              </tr>
              <tr>
                <td>CXCL-1</td>
                <td>&gt;1.16</td>
                <td>0.96(0.93-0.99)</td>
                <td>89.1%</td>
                <td>87.5%</td>
                <td>87.7%</td>
                <td>88.9%</td>
                <td>85.9%</td>
                <td>&lt;0.001</td>
              </tr>
            </tbody>
          </table>
          <table-wrap-foot>
            <fn>
              <p>AUC: Area under curve, CI: Confidence interval, PPV:+ve predicted value, NPV:-ve predicted value, NKILA, NF-KB interacting long noncoding RNA; LINC00993, Long intergenic non-protein coding RNA 00993; NF&#x03BA;B, Nuclear Factor kappa &#x2013;light- chain- enhancer of activated B cells; CXCL1, C-X-C motif chemokine ligand 1.</p>
            </fn>
          </table-wrap-foot>
        </table-wrap>
      </sec>
    </sec>
    <sec sec-type="discussion" id="S4">
      <title>Discussion</title>
      <p id="P23">Breast cancer is the most common cancer in women and represents the leading cause of cancer mortality among this gender worldwide. It stands as the most frequent malignancy in females, thus signifying a principal focus of biomedical research.<xref rid="R12" ref-type="bibr"><sup>12</sup></xref></p>
      <p id="P24">The prevalence and incidence rates of BC are progressively escalating across the world. The National Cancer Registry Program's 2013 report in Egypt reveals that breast cancer is the most pervasive form of cancer among females, accounting for 32% of all female cancer cases.<xref rid="R13" ref-type="bibr"><sup>13</sup></xref>,<xref rid="R14" ref-type="bibr"><sup>14</sup></xref></p>
      <p id="P25">Innovative biomarkers are required for early detection, treatment, and prognosis. Non-coding RNAs (ncRNAs) have emerged as crucial players in various stages of breast cancer tumorigenesis, influencing cell death, metabolism, epithelial-mesenchymal transition (EMT), metastasis, and drug resistance.<xref rid="R15" ref-type="bibr"><sup>15</sup></xref></p>
      <p id="P26">The current study showed a significant decrease in expression levels of lncRNA (NKILA) in tumor tissues compared to normal ones (P &lt; 0.001). NKILA expression levels in tissues showed high sensitivity and specificity, and, therefore, had a significant diagnostic value for BC patients.</p>
      <p id="P27">Consistent with our results, studies by Di Huang et al., Li-Hua Luo et al. also reported a decrease in NKILA expression in BC tissues and its involvement in inhibiting tumor progression, including cell proliferation, migration, and angiogenesis, indicating its potential as a therapeutic target.<xref rid="R16" ref-type="bibr"><sup>16</sup></xref>,<xref rid="R17" ref-type="bibr"><sup>17</sup></xref> Our findings align with those of several other studies on various cancer types, such as non-small cell lung cancer, melanoma, hepatocellular carcinoma (HCC), and rectal cancer, where NKILA expression was also found to be downregulated in tumor tissues.<xref rid="R18" ref-type="bibr"><sup>18</sup></xref>,<xref rid="R21" ref-type="bibr"><sup>21</sup></xref></p>
      <p id="P28">The current study found that altered NKILA expression was associated with specific tumor characteristics in BC, including positive family history, invasive lobular carcinoma, high-grade tumors, negative estrogen, progesterone receptors, and advanced lymph node involvement. These findings suggest that NKILA could serve as an important biomarker in BC diagnosis and prognosis.</p>
      <p id="P29">Consistent with our results, Huang and colleagues found that NKILA levels decreased in breast cancerous tissue compared to non-cancerous tissues and were correlated with lymph node involvement and higher TNM stage.<xref rid="R16" ref-type="bibr"><sup>16</sup></xref> Moreover, studies by Luo and Wu reported correlations between NKILA expression and clinical stage, TNM classification, and EMT features.<xref rid="R17" ref-type="bibr"><sup>17</sup></xref>,<xref rid="R22" ref-type="bibr"><sup>22</sup></xref> Liu et al. found that NKILA expression was an independent prognostic factor. Furthermore, low NKILA expression is associated with breast cancer metastasis and poor patient prognosis which confirms our results.<xref rid="R23" ref-type="bibr"><sup>23</sup></xref></p>
      <p id="P30">NF-&#x03BA;B significantly increased in tumor tissues compared to normal ones (P&lt;0.001) and a significant negative correlation was found between NKILA and NF-&#x03BA;B in breast cancer. This suggests a regulatory interplay between these molecules, where higher NKILA expression is associated with lower NF-&#x03BA;B expression and vice versa. This inverse correlation may indicate that NKILA has a potential inhibitory role in suppressing NF-&#x03BA;B activity, which plays a critical role in cancer-related processes, thereby affecting BC pathogenesis. In accordance with our findings, Huang et al., have demonstrated that NKILA interacts with the NF-&#x03BA;B &#x2013;I&#x03BA;B&#x03B1; complex by binding to p65 and modulates T cell activation-induced cell death by inhibiting NF-&#x03BA;B activity.<xref rid="R16" ref-type="bibr"><sup>16</sup></xref></p>
      <p id="P31">The current study has demonstrated an increase in CXCL-1 expression in BC tissue as compared to normal tissue (P&lt;0.001). This elevation was particularly prominent in cases characterized by tumor sizes exceeding 5, invasive lobular carcinoma (ILC) type, cases graded as 3, and those with tumor stages classified as T3 or T4. These findings underscore the upregulation of CXCL-1 in breast cancer, specifically in aggressive subtypes.</p>
      <p id="P32">These findings are in line with those reported by Wang et al., who found a correlation between elevated CXCL1 expression and advanced cancer stage, lymph node metastasis, and poor survival. The findings highlight the value of the CXCL1- NF-&#x03BA;B axis in stimulating BC growth and metastasis.<xref rid="R24" ref-type="bibr"><sup>24</sup></xref></p>
      <p id="P33">The results showed that CXCL1 and NF-&#x03BA;B may serve as a potential therapeutic target for the prevention of cancer growth metastasis.</p>
      <p id="P34">The current study found a highly significant decrease in LINC00993 expression in breast cancer tumor tissues compared to normal tissues (P &lt; 0.001). LINC00993 expression levels showed high sensitivity and specificity, and thus have a significant diagnostic value for BC patients.</p>
      <p id="P35">In accordance with our results, some studies reported significant downregulation of LINC00993 in TNBC and its association with luminal BC.<xref rid="R8" ref-type="bibr"><sup>8</sup></xref>,<xref rid="R25" ref-type="bibr"><sup>25</sup></xref>,<xref rid="R26" ref-type="bibr"><sup>26</sup></xref></p>
      <p id="P36">The study by Guo et al. found that higher expression of LINC00993 was associated with a better outcome in TNBC patients, indicating its prognostic value.<xref rid="R8" ref-type="bibr"><sup>8</sup></xref></p>
      <p id="P37">Our study found that the expression of LINC00993 was associated with invasive lobular carcinoma (ILC) type, high-grade tumors (Grade 3), and advanced lymph node involvement (N3). These findings suggest that LINC00993 may have a significant role in BC pathogenesis as their expression levels are associated with specific tumor characteristics. Chen et al., demonstrated discernible patterns of LINC00993 expression across various subtypes of BC, thereby underscoring its potential significance in distinguishing between different types of BC. These findings are consistent with the results of our study.<xref rid="R26" ref-type="bibr"><sup>26</sup></xref></p>
      <p id="P38">The current study found a positive correlation between the expression levels of NKILA and LINC00993 in cases of BC. This finding suggests a potential for these lncRNAs to regulate the pathogenesis of BC. The observed positive correlation supports the notion that NKILA and LINC00993 may function in tandem to influence cancer-related pathways or mechanisms in BC. These lncRNAs hold promise as tumor biomarkers and therapeutic targets for personalized BC treatment strategies.</p>
    </sec>
    <sec sec-type="conclusions" id="S5">
      <title>Conclusion</title>
      <p id="P39">These findings suggest that LncRNAs (NKILA, LINC00993) and cytokines (NF-&#x03BA;B and CXCL-1) can be used as novel biomarkers for BC.</p>
      <p id="P40">Our study is a preliminary study in the Egyptian population, showing that LncRNAs (NKILA, LINC00993) and cytokines (NF-&#x03BA;B and CXCL-1) have potential diagnostic value with adequate sensitivity and specificity for BC and could be considered as valuable markers for BC diagnosis. Also, they may be serve as promising prognostic tumor markers, in selecting candidate patients for a more aggressive adjuvant treatment or novel therapeutics options.</p>
      <p id="P41">Future large-scale studies are needed to confirm our findings and to further explore the existing potential of the studied parameters as novel biomarkers for breast cancer in order to be utilized in the clinical field.</p>
    </sec>
  </body>
  <back>
    <ack id="S6">
      <title>Acknowledgements</title>
      <p id="P42">No acknowledgments.</p>
    </ack>
    <sec id="S7">
      <title>Ethical considerations</title>
      <p id="P43">This study was approved by the Ethical Committee of the Faculty of Medicine, Zagazig University, and following the Helsinki Declaration of 2013.</p>
    </sec>
    <sec sec-type="data-availability" id="S8">
      <title>Data availability</title>
      <p id="P44">The corresponding author can be contacted directly for access to the data.</p>
    </sec>
    <ref-list>
      <title>References</title>
      <ref id="R1">
        <label>1</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>DeSantis</surname><given-names>CE</given-names></name>
            <name><surname>Ma</surname><given-names>J</given-names></name>
            <name><surname>Gaudet</surname><given-names>MM</given-names></name>
            <name><surname>Newman</surname><given-names>LA</given-names></name>
            <name><surname>Miller</surname><given-names>KD</given-names></name>
            <name><surname>Goding Sauer</surname><given-names>A</given-names></name>
            <name><surname>Jemal</surname><given-names>A</given-names></name>
            <name><surname>Siegel</surname><given-names>RL</given-names></name>
          </person-group>
          <article-title>Breast cancer statistics, 2019</article-title>.
          <source>CA Cancer J Clin</source>.
          <year>2019</year> ;<volume>69</volume>(<issue>6</issue>):<fpage>438</fpage>-<lpage>451</lpage>. doi: <pub-id pub-id-type="doi">10.3322/caac.21583</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R2">
        <label>2</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Huang</surname><given-names>J</given-names></name>
            <name><surname>Chan</surname><given-names>PS</given-names></name>
            <name><surname>Lok</surname><given-names>V</given-names></name>
            <name><surname>Chen</surname><given-names>X</given-names></name>
            <name><surname>Ding</surname><given-names>H</given-names></name>
            <name><surname>Jin</surname><given-names>Y</given-names></name>
            <name><surname>Yuan</surname><given-names>J</given-names></name>
            <name><surname>Lao</surname><given-names>XQ</given-names></name>
            <name><surname>Zheng</surname><given-names>ZJ</given-names></name>
            <name><surname>Wong</surname><given-names>MC</given-names></name>
          </person-group>
          <article-title>Global incidence and mortality of breast cancer: a trend analysis</article-title>.
          <source>Aging (Albany NY)</source>.
          <year>2021</year> ;<volume>13</volume>(<issue>4</issue>):<fpage>5748</fpage>-<lpage>5803</lpage>. doi: <pub-id pub-id-type="doi">10.18632/aging.202502</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R3">
        <label>3</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Ahmed</surname><given-names>RA</given-names></name>
            <name><surname>Yussif</surname><given-names>SM</given-names></name>
          </person-group>
          <article-title>Immunohistochemical detection of human cytomegalovirus, Epstein-Barr virus and human papillomavirus in invasive breast carcinoma in Egyptian women: A tissue microarray study</article-title>.
          <source>J Solid Tumors</source>.
          <year>2016</year>; <volume>6</volume>(<issue>2</issue>): <fpage>8</fpage>-<lpage>16</lpage>. DOI:<pub-id pub-id-type="doi">10.5430/jst.v6n2P8</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R4">
        <label>4</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Britt</surname><given-names>KL</given-names></name>
            <name><surname>Cuzick</surname><given-names>J</given-names></name>
            <name><surname>Phillips</surname><given-names>KA</given-names></name>
          </person-group>
          <article-title>Key steps for effective breast cancer prevention</article-title>.
          <source>Nat Rev Cancer</source>.
          <year>2020</year>;<volume>20</volume>(<issue>8</issue>):<fpage>417</fpage>-<lpage>436</lpage>. doi: <pub-id pub-id-type="doi">10.1038/s41568-020-0266-x</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R5">
        <label>5</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Salimimoghadam</surname><given-names>S</given-names></name>
            <name><surname>Taefehshokr</surname><given-names>S</given-names></name>
            <name><surname>Loveless</surname><given-names>R</given-names></name>
            <name><surname>Teng</surname><given-names>Y</given-names></name>
            <name><surname>Bertoli</surname><given-names>G</given-names></name>
            <name><surname>Taefehshokr</surname><given-names>N</given-names></name>
            <etal/>
          </person-group>
          <article-title>The role of tumor suppressor short non-coding RNAs on breast cancer</article-title>.
          <source>Crit Rev Oncol Hematol</source>.
          <year>2021</year>; <volume>158</volume>:<fpage>103210</fpage>. doi: <pub-id pub-id-type="doi">10.1016/j.critrevonc.2020.103210</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R6">
        <label>6</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Dykes</surname><given-names>IM</given-names></name>
            <name><surname>Emanueli</surname><given-names>C</given-names></name>
          </person-group>
          <article-title>Transcriptional and Post-transcriptional Gene Regulation by Long Non-coding RNA</article-title>.
          <source>Genomics Proteomics Bioinformatics</source>.
          <year>2017</year> ;<volume>15</volume>(<issue>3</issue>):<fpage>177</fpage>-<lpage>186</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.gpb.2016.12.005</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R7">
        <label>7</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Schmitt</surname><given-names>AM</given-names></name>
            <name><surname>Chang</surname><given-names>HY</given-names></name>
          </person-group>
          <article-title>Long noncoding RNAs in cancer pathways</article-title>.
          <source>Cancer cell</source>.
          <year>2016</year>; <volume>29</volume>(<issue>4</issue>):<fpage>452</fpage>-<lpage>463</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.ccell.2016.03.010</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R8">
        <label>8</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Guo</surname><given-names>S</given-names></name>
            <name><surname>Jian</surname><given-names>L</given-names></name>
            <name><surname>Tao</surname><given-names>K</given-names></name>
            <name><surname>Chen</surname><given-names>C</given-names></name>
            <name><surname>Yu</surname><given-names>H</given-names></name>
            <name><surname>Liu</surname><given-names>S</given-names></name>
          </person-group>
          <article-title>Novel Breast-Specific Long Non-coding RNA LINC00993 Acts as a Tumor Suppressor in Triple-Negative Breast Cancer</article-title>.
          <source>Front Oncol</source>.
          <year>2019</year>; <volume>9</volume>:<fpage>1325</fpage>. doi: <pub-id pub-id-type="doi">10.3389/fonc.2019.01325</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R9">
        <label>9</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Singh</surname><given-names>A</given-names></name>
            <name><surname>Martinez-Yamout</surname><given-names>MA</given-names></name>
            <name><surname>Wright</surname><given-names>PE</given-names></name>
            <name><surname>Dyson</surname><given-names>HJ</given-names></name>
          </person-group>
          <article-title>Interactions of a Long Noncoding RNA with Domains of NF-&#x03BA;B and I&#x03BA;B&#x03B1;: Implications for the Inhibition of Non-Signal-Related Phosphorylation</article-title>.
          <source>Biochemistry</source>.
          <year>2022</year> ;<volume>61</volume>(<issue>5</issue>):<fpage>367</fpage>-<lpage>376</lpage>. doi: <pub-id pub-id-type="doi">10.1021/acs.biochem.1c00732</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R10">
        <label>10</label>
        <mixed-citation publication-type="book">
          <person-group person-group-type="author">
            <name><surname>Sobin</surname><given-names>LH</given-names></name>
            <name><surname>Gospodarowicz</surname><given-names>MK</given-names></name>
            <name><surname>Wittekind</surname><given-names>C</given-names></name>
          </person-group>
          <source>TNM Classification of Malignant Tumours</source>,
          <edition>7th edn</edition>,
          <year>2010</year>. p. <fpage>336</fpage>, <publisher-name>WileyBlackwell</publisher-name>, <publisher-loc>Hoboken, NY</publisher-loc>
        </mixed-citation>
      </ref>
      <ref id="R11">
        <label>11</label>
        <mixed-citation publication-type="book">
          <person-group person-group-type="author">
            <name><surname>Pal</surname><given-names>A</given-names></name>
          </person-group>
          <source>Protocols in Advanced Genomics and allied techniques</source>.
          <publisher-name>Springer US</publisher-name>; <year>2022</year>.
        </mixed-citation>
      </ref>
      <ref id="R12">
        <label>12</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Bray</surname><given-names>F</given-names></name>
            <name><surname>Ferlay</surname><given-names>J</given-names></name>
            <name><surname>Soerjomataram</surname><given-names>I</given-names></name>
            <name><surname>Siegel</surname><given-names>RL</given-names></name>
            <name><surname>Torre</surname><given-names>LA</given-names></name>
            <name><surname>Jemal</surname><given-names>A</given-names></name>
          </person-group>
          <article-title>Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries</article-title>.
          <source>CA Cancer J Clin</source>.
          <year>2018</year>;<volume>68</volume>(<issue>6</issue>):<fpage>394</fpage>-<lpage>424</lpage>. doi: <pub-id pub-id-type="doi">10.3322/caac.21492</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R13">
        <label>13</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Ibrahim</surname><given-names>AS</given-names></name>
            <name><surname>Khaled</surname><given-names>HM</given-names></name>
            <name><surname>Mikhail</surname><given-names>NN</given-names></name>
            <name><surname>Baraka</surname><given-names>H</given-names></name>
            <name><surname>Kamel</surname><given-names>H</given-names></name>
          </person-group>
          <article-title>Cancer incidence in egypt: results of the national population-based cancer registry program</article-title>.
          <source>J Cancer Epidemiol</source>.
          <year>2014</year>; <volume>2014</volume>:<fpage>437971</fpage>. doi: <pub-id pub-id-type="doi">10.1155/2014/437971</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R14">
        <label>14</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Massarweh</surname><given-names>SA</given-names></name>
            <name><surname>Sledge</surname><given-names>GW</given-names></name>
            <name><surname>Miller</surname><given-names>DP</given-names></name>
            <name><surname>McCullough</surname><given-names>D</given-names></name>
            <name><surname>Petkov</surname><given-names>VI</given-names></name>
            <name><surname>Shak</surname><given-names>S</given-names></name>
          </person-group>
          <article-title>Molecular Characterization and Mortality From Breast Cancer in Men</article-title>.
          <source>J Clin Oncol</source>.
          <year>2018</year> ;<volume>36</volume>(<issue>14</issue>):<fpage>1396</fpage>-<lpage>1404</lpage>. doi: <pub-id pub-id-type="doi">10.1200/JCO.2017.76.8861</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R15">
        <label>15</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Amelio</surname><given-names>I</given-names></name>
            <name><surname>Bernassola</surname><given-names>F</given-names></name>
            <name><surname>Candi</surname><given-names>E</given-names></name>
          </person-group>
          <article-title>Emerging roles of long non-coding RNAs in breast cancer biology and management</article-title>.
          <source>Semin Cancer Biol</source>.
          <year>2021</year> ;<volume>72</volume>:<fpage>36</fpage>-<lpage>45</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.semcancer.2020.06.019</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R16">
        <label>16</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Huang</surname><given-names>D</given-names></name>
            <name><surname>Chen</surname><given-names>J</given-names></name>
            <name><surname>Yang</surname><given-names>L</given-names></name>
            <name><surname>Ouyang</surname><given-names>Q</given-names></name>
            <name><surname>Li</surname><given-names>J</given-names></name>
            <name><surname>Lao</surname><given-names>L</given-names></name>
            <etal/>
          </person-group>
          <article-title>NKILA lncRNA promotes tumor immune evasion by sensitizing T cells to activation-induced cell death</article-title>.
          <source>Nat Immunol</source>.
          <year>2018</year> ;<volume>19</volume>(<issue>10</issue>):<fpage>1112</fpage>-<lpage>1125</lpage>. doi: <pub-id pub-id-type="doi">10.1038/s41590-018-0207-y</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R17">
        <label>17</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Luo</surname><given-names>LH</given-names></name>
            <name><surname>Rao</surname><given-names>L</given-names></name>
            <name><surname>Luo</surname><given-names>LF</given-names></name>
            <name><surname>Chen</surname><given-names>K</given-names></name>
            <name><surname>Ran</surname><given-names>RZ</given-names></name>
            <name><surname>Liu</surname><given-names>XL</given-names></name>
          </person-group>
          <article-title>Long non-coding RNA NKILA inhibited angiogenesis of breast cancer through NF-&#x03BA;B/IL-6 signaling pathway</article-title>.
          <source>Microvasc Res</source>.
          <year>2020</year>;<volume>129</volume>:<fpage>103968</fpage>. doi: <pub-id pub-id-type="doi">10.1016/j.mvr.2019.103968</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R18">
        <label>18</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Bian</surname><given-names>D</given-names></name>
            <name><surname>Gao</surname><given-names>C</given-names></name>
            <name><surname>Bao</surname><given-names>K</given-names></name>
            <name><surname>Song</surname><given-names>G</given-names></name>
          </person-group>
          <article-title>The long non-coding RNA NKILA inhibits the invasion-metastasis cascade of malignant melanoma via the regulation of NF-&#x0138;B</article-title>.
          <source>Am J Cancer Res</source>.
          <year>2017</year> ;<volume>7</volume>(<issue>1</issue>):<fpage>28</fpage>-<lpage>40</lpage>.
        </mixed-citation>
      </ref>
      <ref id="R19">
        <label>19</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Lu</surname><given-names>Z</given-names></name>
            <name><surname>Li</surname><given-names>Y</given-names></name>
            <name><surname>Wang</surname><given-names>J</given-names></name>
            <name><surname>Che</surname><given-names>Y</given-names></name>
            <name><surname>Sun</surname><given-names>S</given-names></name>
            <name><surname>Huang</surname><given-names>J</given-names></name>
            <etal/>
          </person-group>
          <article-title>Long non-coding RNA NKILA inhibits migration and invasion of non-small cell lung cancer via NF-&#x03BA;B/Snail pathway</article-title>.
          <source>J Exp Clin Cancer Res</source>.
          <year>2017</year> ;<volume>36</volume>(<issue>1</issue>):<fpage>54</fpage>. doi: <pub-id pub-id-type="doi">10.1186/s13046-017-0518-0</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R20">
        <label>20</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Tao</surname><given-names>F</given-names></name>
            <name><surname>Xu</surname><given-names>Y</given-names></name>
            <name><surname>Yang</surname><given-names>D</given-names></name>
            <name><surname>Tian</surname><given-names>B</given-names></name>
            <name><surname>Jia</surname><given-names>Y</given-names></name>
            <name><surname>Hou</surname><given-names>J</given-names></name>
            <etal/>
          </person-group>
          <article-title>LncRNA NKILA correlates with the malignant status and serves as a tumor-suppressive role in rectal cancer</article-title>.
          <source>J Cell Biochem</source>.
          <year>2018</year> ;<volume>119</volume>(<issue>12</issue>):<fpage>9809</fpage>-<lpage>9816</lpage>. doi: <pub-id pub-id-type="doi">10.1002/jcb.27300</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R21">
        <label>21</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Chen</surname><given-names>R</given-names></name>
            <name><surname>Cheng</surname><given-names>Q</given-names></name>
            <name><surname>Owusu-Ansah</surname><given-names>KG</given-names></name>
            <name><surname>Song</surname><given-names>G</given-names></name>
            <name><surname>Jiang</surname><given-names>D</given-names></name>
            <name><surname>Zhou</surname><given-names>L</given-names></name>
            <etal/>
          </person-group>
          <article-title>a prognostic indicator, inhibits tumor metastasis by suppressing NF-&#x03BA;B/Slug mediated epithelial-mesenchymal transition in hepatocellular carcinoma</article-title>.
          <source>Int J Biol Sci</source>.
          <year>2020</year> ;<volume>16</volume>(<issue>3</issue>):<fpage>495</fpage>-<lpage>503</lpage>. doi: <pub-id pub-id-type="doi">10.7150/ijbs.39582</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R22">
        <label>22</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Wu</surname><given-names>W</given-names></name>
            <name><surname>Chen</surname><given-names>F</given-names></name>
            <name><surname>Cui</surname><given-names>X</given-names></name>
            <name><surname>Yang</surname><given-names>L</given-names></name>
            <name><surname>Chen</surname><given-names>J</given-names></name>
            <name><surname>Zhao</surname><given-names>J</given-names></name>
            <etal/>
          </person-group>
          <article-title>LncRNA NKILA suppresses TGF-&#x03B2;-induced epithelial-mesenchymal transition by blocking NF-&#x03BA;B signalling in breast cancer</article-title>.
          <source>Int J Cancer</source>.
          <year>2018</year>;<volume>143</volume>(<issue>9</issue>):<fpage>2213</fpage>-<lpage>2224</lpage>. doi: <pub-id pub-id-type="doi">10.1002/ijc.31605</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R23">
        <label>23</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Liu</surname><given-names>B</given-names></name>
            <name><surname>Sun</surname><given-names>L</given-names></name>
            <name><surname>Liu</surname><given-names>Q</given-names></name>
            <name><surname>Gong</surname><given-names>C</given-names></name>
            <name><surname>Yao</surname><given-names>Y</given-names></name>
            <name><surname>Lv</surname><given-names>X</given-names></name>
            <etal/>
          </person-group>
          <article-title>A cytoplasmic NF-&#x03BA;B interacting long noncoding RNA blocks I&#x03BA;B phosphorylation and suppresses breast cancer metastasis</article-title>.
          <source>Cancer Cell</source>.
          <year>2015</year> ;<volume>27</volume>(<issue>3</issue>):<fpage>370</fpage>-<lpage>381</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.ccell.2015.02.004</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R24">
        <label>24</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Wang</surname><given-names>N</given-names></name>
            <name><surname>Liu</surname><given-names>W</given-names></name>
            <name><surname>Zheng</surname><given-names>Y</given-names></name>
            <name><surname>Wang</surname><given-names>S</given-names></name>
            <name><surname>Yang</surname><given-names>B</given-names></name>
            <name><surname>Li</surname><given-names>M</given-names></name>
            <etal/>
          </person-group>
          <article-title>CXCL1 derived from tumor-associated macrophages promotes breast cancer metastasis via activating NF-&#x03BA;B/SOX4 signaling</article-title>.
          <source>Cell Death Dis</source>.
          <year>2018</year> ;<volume>9</volume>(<issue>9</issue>):<fpage>880</fpage>. doi: <pub-id pub-id-type="doi">10.1038/s41419-018-0876-3</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R25">
        <label>25</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Chen</surname><given-names>C</given-names></name>
            <name><surname>Li</surname><given-names>Z</given-names></name>
            <name><surname>Yang</surname><given-names>Y</given-names></name>
            <name><surname>Xiang</surname><given-names>T</given-names></name>
            <name><surname>Song</surname><given-names>W</given-names></name>
            <name><surname>Liu</surname><given-names>S</given-names></name>
          </person-group>
          <article-title>Microarray expression profiling of dysregulated long non-coding RNAs in triple-negative breast cancer</article-title>.
          <source>Cancer Biol Ther</source>.
          <year>2015</year>;<volume>16</volume>(<issue>6</issue>):<fpage>856</fpage>-<lpage>865</lpage>. doi: <pub-id pub-id-type="doi">10.1080/15384047.2015.1040957</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R26">
        <label>26</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Chen</surname><given-names>C</given-names></name>
            <name><surname>Yang</surname><given-names>L</given-names></name>
            <name><surname>Rivandi</surname><given-names>M</given-names></name>
            <name><surname>Franken</surname><given-names>A</given-names></name>
            <name><surname>Fehm</surname><given-names>T</given-names></name>
            <name><surname>Neubauer</surname><given-names>H</given-names></name>
          </person-group>
          <article-title>Bioinformatic Identification of a Breast-Specific Transcript Profile</article-title>.
          <source>Proteomics Clin Appl</source>.
          <year>2020</year> ;<volume>14</volume>(<issue>6</issue>):<fpage>e2000007</fpage>. doi: <pub-id pub-id-type="doi">10.1002/prca.202000007</pub-id>.
        </mixed-citation>
      </ref>
    </ref-list>
  </back>
</article>