<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "https://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd">
<article xmlns:xlink="http://www.w3.org/1999/xlink" 
         xmlns:mml="http://www.w3.org/1998/Math/MathML" 
         xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance"
         xmlns:ali="http://www.niso.org/schemas/ali/1.0/"
         article-type="research-article" 
         dtd-version="1.2" 
         xml:lang="en">
  <?properties manuscript?>
  <?origin nihpa?>
  <front>
    <journal-meta>
      <journal-id journal-id-type="publisher-id">abc</journal-id>
      <journal-title-group>
        <journal-title>Archives of Breast Cancer</journal-title>
        <abbrev-journal-title abbrev-type="pubmed">Arch Breast Cancer</abbrev-journal-title>
      </journal-title-group>
      <issn pub-type="ppub">2383-0425</issn>
      <issn pub-type="epub">2383-0433</issn>
      <publisher>
        <publisher-name>Farname Inc.</publisher-name>
      </publisher>
    </journal-meta>
    <article-meta>
      <article-id pub-id-type="doi">10.32768/abc.2025122171-180</article-id>
      <article-id pub-id-type="manuscript">1051</article-id>
      <article-version vocab="JAV" vocab-identifier="http://www.niso.org/publications/rp/RP-8-2008.pdf" 
        article-version-type="VoR" vocab-term="Version of Record">version-of-record</article-version>
      <article-categories>
        <subj-group subj-group-type="heading">
          <subject>Original Article</subject>
        </subj-group>
      </article-categories>
      <title-group>
        <article-title>The Impact of miRNA-425 and miRNA-373 on the Pathogenesis of Breast Cancer</article-title>
      </title-group>
      <contrib-group>
        <contrib contrib-type="author" corresp="yes">
          <name>
            <surname>Nayyef</surname>
            <given-names>Hanan Jawad</given-names>
          </name>
          <email>hanan.nayyef@uobaghdad.edu.iq</email>
          <xref ref-type="aff" rid="aff1">a</xref>
          <xref ref-type="aff" rid="aff2">b</xref>
          <xref ref-type="corresp" rid="cor1">*</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Aziz</surname>
            <given-names>Ismail Hussien</given-names>
          </name>
          <xref ref-type="aff" rid="aff2">b</xref>
        </contrib>
      </contrib-group>
      <aff id="aff1">
        <label>a</label>
        <institution>Institute of Genetic Engineering and Biotechnology for Postgraduate Studies, University of Baghdad</institution>, <city>Baghdad</city>, <country country="IQ">Iraq</country>
      </aff>
      <aff id="aff2">
        <label>b</label>
        <institution>Tropical Biological Research Unit, College of Science, University of Baghdad</institution>, <city>Baghdad</city>, <country country="IQ">Iraq</country>
      </aff>
      <author-notes>
        <corresp id="cor1">
          <label>*</label>
          Address for correspondence: Hanan Jawad Nayyef,
          <institution>Institute of Genetic Engineering and Biotechnology for Postgraduate Studies, University of Baghdad</institution>, <city>Baghdad</city>,
          <country>Iraq</country>.
          Email: <email>hanan.nayyef@uobaghdad.edu.iq</email>
        </corresp>
        <fn fn-type="coi-statement">
          <p>The authors declare that they have no competing interests.</p>
        </fn>
      </author-notes>
      <pub-date date-type="pub" publication-format="print" iso-8601-date="2025">
        <year>2025</year>
      </pub-date>
      <pub-date date-type="pub" publication-format="electronic" iso-8601-date="2025">
        <year>2025</year>
      </pub-date>
      <volume>12</volume>
      <issue>2</issue>
      <fpage>171</fpage>
      <lpage>180</lpage>
      <history>
        <date date-type="received" iso-8601-date="2024-11-16">
          <day>16</day>
          <month>11</month>
          <year>2024</year>
        </date>
        <date date-type="rev-recd" iso-8601-date="2024-12-18">
          <day>18</day>
          <month>12</month>
          <year>2024</year>
        </date>
        <date date-type="accepted" iso-8601-date="2025-02-01">
          <day>01</day>
          <month>02</month>
          <year>2025</year>
        </date>
      </history>
      <permissions>
        <copyright-statement>Copyright &#x00A9; 2025 Archives of Breast Cancer</copyright-statement>
        <copyright-year>2025</copyright-year>
        <copyright-holder>Archives of Breast Cancer</copyright-holder>
        <license license-type="open-access">
          <license-p>
            This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License 
            (<ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by-nc/4.0/" xlink:title="Creative Commons Attribution-NonCommercial 4.0 International License">Creative Commons Attribution-NonCommercial 4.0 International License</ext-link>), 
            which permits copy and redistribution of the material in any medium or format or adapt, remix, transform, and build upon the material for any purpose, except for commercial purposes.
          </license-p>
          <ali:license_ref>https://creativecommons.org/licenses/by-nc/4.0/</ali:license_ref>
        </license>        
      </permissions>
      <self-uri xlink:href="https://www.archbreastcancer.com/index.php/abc/article/view/1051" content-type="pdf" xlink:title="PDF Full Text"/>
      <abstract>
        <sec id="S_ABS_BKG">
          <title>Background</title>
          <p id="P1">Biomarkers that monitor treatment efficacy could be very useful for early response evaluation, therapy direction, and prognosis prediction. MicroRNAs (miRNAs), a type of noncoding RNA that is only 22 nucleotides long regulate genes after transcription has taken place. miRNAs are essential regulators of cancer biology and are involved in the regulation of key processes such as cell proliferation, apoptosis, migration, and metastasis.</p>
        </sec>
        <sec id="S_ABS_METH">
          <title>Methods</title>
          <p id="P2">This study included 100 women with breast cancer (BC) who attended Al-Amal Hospital in Baghdad, Iraq between June 2023 and October 2023. The parameters were evaluated using questionnaires and medical records, including human epidermal growth factor receptor 2 (HER2) receptors, disease progesterone (PR), grade, age, tumor stage, family history, type, location, and estrogen (ER).</p>
        </sec>
        <sec id="S_ABS_RES">
          <title>Results</title>
          <p id="P3">Serum levels of CEA (median (IQR)) were significantly higher in patients with BC than in healthy controls (HCs), 104.05pg/ml versus 26.85 pg/ml (P&lt; 0.001). Serum levels of RETN (median (IQR)) were significantly higher in the BC group in comparison with HCs, 1.16 ng/ml versus 0.41 ng/ml, respectively (P&lt; 0.001). The expression levels of miR-373 were significantly higher in the BC group than in the HCs (median (IQR)), 3.54 (8.23) fold change versus 1 fold change, respectively (P&lt; 0.001). The expression levels of miR-425 were significantly higher in the BC group than in the HCs (median (IQR)), 4.80 (10.22) versus 1 fold change, respectively (P&lt; 0.001).</p>
        </sec>
        <sec id="S_ABS_CONCL">
          <title>Conclusion</title>
          <p id="P4">The biomarkers CEA, RETN, miR-373, and miR-425 were identified as promising candidates for enhancing the diagnostic workup, prognosis, and therapy of BC. CEA and RETN are established markers that aid in the early detection and monitoring of tumor progression, whereas miR-373 and miR-425 are involved in critical processes such as tumor metastasis, EMT, and chemo resistance.</p>
        </sec>
      </abstract>
      <kwd-group>
        <title>Keywords</title>
        <kwd>BC</kwd>
        <kwd>CEA</kwd>
        <kwd>RETN</kwd>
        <kwd>miR-373</kwd>
        <kwd>miR-425</kwd>
      </kwd-group>
      <funding-group>
        <funding-statement>No funding was received to conduct this work.</funding-statement>
      </funding-group>
    </article-meta>
  </front>
  <body>
    <sec sec-type="intro" id="S1">
      <title>Introduction</title>
      <p id="P5">Breast cancer (BC) is the second most common cause of death in women worldwide.<xref rid="R1" ref-type="bibr"><sup>1</sup></xref>&#x2013;<xref rid="R3" ref-type="bibr"><sup>3</sup></xref> It arises from uncontrollably altered cell proliferation or function in breast tissue. These alterations cause these cells to become malignant and capable of spreading.<xref rid="R4" ref-type="bibr"><sup>4</sup></xref>,<xref rid="R5" ref-type="bibr"><sup>5</sup></xref> Biomarkers that aid in monitoring treatment effectiveness may be particularly beneficial.<xref rid="R6" ref-type="bibr"><sup>6</sup></xref> Regulating genes after transcription is the job of microRNAs, a type of noncoding RNA that is only 22 nucleotides long. Differentiation, cell proliferation, metabolic processes, and cell death are all affected by the ability to impede mRNA translation. Recent studies have shown a connection between abnormal miRNA expression and the onset of many disorders including cancer.<xref rid="R7" ref-type="bibr"><sup>7</sup></xref>,<xref rid="R8" ref-type="bibr"><sup>8</sup></xref> A member of a similar family of cell surface glycoproteins is a clinically significant tumor marker. Tumor tissue extracts and normal fetal gastrointestinal tract epithelial cells contain this tumor marker, which is useful for identifying colorectal, gastrointestinal, lung, and breast cancers. Lysine is located at the N-terminus of CEA, which is a glycoprotein. CEA consists of one polypeptide chain with 641 amino acids and 45-50% carbohydrates.<xref rid="R9" ref-type="bibr"><sup>9</sup></xref>,<xref rid="R10" ref-type="bibr"><sup>10</sup></xref> Serum CEA levels tend to increase in patients with advanced BC. The clinical use of blood CEA in tracking treatment efficacy in metastatic BC patients, particularly those with bone metastases, has been shown in our research.<xref rid="R3" ref-type="bibr"><sup>3</sup></xref>,<xref rid="R11" ref-type="bibr"><sup>11</sup></xref>,<xref rid="R12" ref-type="bibr"><sup>12</sup></xref> Human macrophages and mouse adipocytes release the hormone protein resistin, which has a molecular weight of 12 kDa and is rich in cysteine. It has 108 amino acid peptides and is a progenitor of the resistin-like molecule (RELM) hormone family. In humans, it circulates as a dimer of two 92-amino acid polypeptides.<xref rid="R13" ref-type="bibr"><sup>13</sup></xref> Resistin enhances epithelial-mesenchymal transition and stemness in BC cells via a signalling pathway involving TLR4, NF-&#x03BA;B, STAT3, and TLR4-specific antibodies and antagonists. These pathways are crucial for metastasis and tumorigenesis.<xref rid="R14" ref-type="bibr"><sup>14</sup></xref> Resistin enhances MCF-7 cell migration and invasion to varying degrees, and its role (MCF-7 cell line) is a key model for studying BC due to its well-characterized estrogen receptor-positive (ER+) status, its ability to form tumors in vivo, and its use in drug resistance and stem cell research. Research has showed that resistin encourages BC cells to invade and migrate<xref rid="R15" ref-type="bibr"><sup>15</sup></xref> in Iraqi women diagnosed with BC. in a study aimed to evaluate the expression of miRNA-425 and miRNA-373 genes as well as the blood levels of CEA and resistin.</p>
    </sec>
    <sec sec-type="methods" id="S2">
      <title>Methods</title>
      <p id="P6">This study included 100 womens with BC who attended Al-Amal Hospital in Baghdad, Iraq, for the period from June 2023 to October 2023. The experimental work was carried out at the Institute for Genetic Engineering and Biotechnology Institute for Postgraduate Studies at the University of Baghdad and laboratories of Al-Amal Hospital. The parameters were evaluated using questionnaires and medical records, including disease grade, human epidermal growthfactorreceptor2 (HER2) receptors, age, tumor stage, family history, type, location, estrogen (ER), and progesterone (PR). Women who were 20 years or older and had a history of BC without treatment were included. Individuals with other malignancies, chronic inflammatory illnesses, history of exposure to hormone treatment, radiation, or chemotherapy, and individuals with other cancers were excluded from the study. Overall, 100 healthy women were age-matched with BC patients to rule out their effect on genetic results.</p>
      <sec id="S3">
        <title>Collection of blood samples</title>
        <p id="P7">Four mL of peripheral blood from the patient and HCss was drawn into a gel tube and coagulated for approximately 15-20 minutes. The coagulated blood was placed in a centrifuge at a speed of 3000 rpm for 15 min, and the sera obtained for each individual were divided into an aliquot of 0.4 mL of serum which was added to TRIzol&#x2122; (0.5 mL) reagent for RNA extraction and the residual serum which was used for the ELISA test (to detect CEA and resistin serum levels).</p>
      </sec>
      <sec id="S4">
        <title>Gene expression of miRNA-373 and miRNA-425</title>
        <sec id="S5">
          <title>Total RNA extraction</title>
          <p id="P8">The TRIzol RNA isolation kit (ELK Biotechnology, China) was used to separate total RNA from whole blood samples of both patients and healthy controls, in accordance with the protocols provided by the manufacturer. A Quantus Fluorometer (Promega) was used to evaluate the purity and concentration of the extracted RNA to determine the quality of samples for subsequent RT-qPCR analysis. RNA samples were stored at (-80&#x02DA;C) until processing for downstream applications.</p>
        </sec>
        <sec id="S6">
          <title>Primer design for microRNA-373and microRNA-425 gene expression</title>
          <p id="P9">Primer sequences for the microRNA-373 gene, microRNA-425, and microRNA-16 (a housekeeping gene) were obtained from the NCBI GenBank database (Table 1).</p>
          <table-wrap id="T1" position="float">
            <label>Table 1</label>
            <caption>
              <title>The primers sequences included in this work</title>
            </caption>
            <table>
              <thead>
                <tr>
                  <th>Primers</th>
                  <th>Sequence (5&#x2019; &#x2013; 3&#x2019;)</th>
                  <th>Band Size (bp)</th>
                  <th>Optimized temperature</th>
                </tr>
              </thead>
              <tbody>
                <tr>
                  <td>miR-425 RT-primer</td>
                  <td>GTTGGCTCTGGTGCAGGGTCCGAGGGTATTCGCACCAGAGCCAACTCAACG</td>
                  <td>50</td>
                  <td>60</td>
                </tr>
                <tr>
                  <td>miR-425 F</td>
                  <td>GGTTTTTTTTAGCAGCACGTAAAT</td>
                  <td>24</td>
                  <td>60</td>
                </tr>
                <tr>
                  <td>miR-373 RT-primer</td>
                  <td>GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACGGAAAG</td>
                  <td>50</td>
                  <td>62</td>
                </tr>
                <tr>
                  <td>miR-373 F</td>
                  <td>GGTTTTTTTACTCAAAATGGGGGCG</td>
                  <td>25</td>
                  <td>62</td>
                </tr>
                <tr>
                  <td>Universal Reverse</td>
                  <td>GTGCAGGGTCCGAGGT</td>
                  <td>16</td>
                  <td/>
                </tr>
                <tr>
                  <td>miR-16-1 RT-primer</td>
                  <td>GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACCGCCAAT</td>
                  <td>51</td>
                  <td>59</td>
                </tr>
                <tr>
                  <td>miR-16-F</td>
                  <td>GGTTTTTTTTAGCAGCACGTAAAT</td>
                  <td>24</td>
                  <td>59</td>
                </tr>
              </tbody>
            </table>
          </table-wrap>
        </sec>
        <sec id="S7">
          <title>Synthesis of cDNA from microRNA</title>
          <p id="P10">An EntiLinkTM Reverse Transcriptase kit (EQ002) was used. The process for reverse transcription of cDNA in a thermal cycler included an initial incubation at 25&#x00B0;C for 5 min, an hour of incubation at 42&#x00B0;C for the cDNA synthesis reaction, and finally 5 min of inactivation of the enzyme. When preparing cDNA for further PCR amplification, it is essential to preserve the results at -20&#x00B0;C.</p>
        </sec>
        <sec id="S8">
          <title>qRT-PCR for microRNA</title>
          <p id="P11">miRNA expression levels were estimated using qRT-PCR. The EnTurboTM SYBR Green PCR SuperMix, manufactured by ELK Biotechnology in China, is a 2X reaction mix that has been fine-tuned for use with qRT-PCR equipment that uses the SYBR&#x00AE;/ROX channel to detect and quantify target miRNAs. An innovative passive reference dye (New England Biolabs, UK) was used in its formulation, which was compatible with hot-start Taq DNA polymerase. Two times the recommended amount of SYBR Green PCR Master Mix was used in the reaction mixture. The total volume was 20&#x03BC;L, and the components were as follows: ROX Dye 0.4&#x03BC;L, Forward primer 0.4&#x03BC;L, Reverse primer 0.4&#x03BC;L, Nuclease-Free Water 5.8&#x03BC;L, cDNA 3&#x03BC;L. A thermocycling procedure was used to configure the RT-PCR protocol.</p>
          <p id="P12">The initial denaturation and denaturation temperatures were 95&#x00B0;C and 45&#x00B0;C, respectively, whereas the annealing and extension temperatures were 59&#x00B0;C and 72&#x00B0;C, respectively.</p>
        </sec>
      </sec>
      <sec id="S9">
        <title>miRNA425 and miRNA373 Gene Expression Calculation</title>
        <p id="P13">The technique originally presented by Livak and Schmittgen (2001) was used to measure fold differences in the mature RNAs' quantitative expression, known as the relative cycle threshold (2<sup>-&#x0394;&#x0394;Ct</sup>). What establishes this ratio is the relative gene expression ratio between the test group and the HCs. Reduced gene expression or downregulation is indicated by values between 0 and 1, whereas a change of 1 indicates no change. Upregulated or enhanced gene expression is indicated by numbers greater than 1. Target gene expression was normalized by establishing appropriate thresholds to obtain accurate Ct values from RT-PCR. Double delta Ct (threshold cycle) analysis was used to assess the expression of miRNA425 and miRNA373 genes, in which miRNA16 was the housekeeping reference gene (HKG). The results of the computations were as follows. Each sample Ct was determined using a real-time cycler program. We estimated the mean values after running each sample twice. For both patients and controls, Ct values were recorded for the housekeeping gene (miRNA16) as well as the target genes (miRNA425 and miRNA373).</p>
      </sec>
      <sec id="S10">
        <title>Tumor Markers</title>
        <p id="P14">CEA is a tumor marker that was measured using a kit according to ELK Biotechnology Co., Ltd. (Cat: ELK026ES). RETN is a tumor marker that was measured using a kit according to ELK Biotechnology CO., Ltd.Cat: ELK1225</p>
      </sec>
      <sec id="S11">
        <title>Statistical Analysis</title>
        <p id="P15">Data analysis was performed using the SPSS, version 27. When estimating quantitative parametric outcomes, median and interquartile range were used, whereas standard deviations and means were used to derive qualitative non-parametric data. To further compare the data and find the connection between the different research parameters, the Pearson Chi-square test and Spearman relation test were used. A P-value below 0.05 was considered significant at the 95% confidence level. Using ROC analysis, we were able to quantify the AUC that predicted the relevance of a parameter, together with its specificity and sensitivity.</p>
      </sec>
    </sec>
    <sec sec-type="results" id="S12">
      <title>Results</title>
      <sec id="S13">
        <title>Comparison of mean age between patients and HCs and the clinicopathological characteristics of BC of women enrolled in this study</title>
        <p id="P16">No significant difference in the mean age was seen between the BC group and HCs, with values of 54.86 &#x00B1; 10.77 years and 54.61 &#x00B1; 9.53 years, respectively (P = 0.862) (Table 2).</p>
        <table-wrap id="T2" position="float">
          <label>Table 2</label>
          <caption>
            <title>Comparison of mean age between patients and HCs</title>
          </caption>
          <table>
            <thead>
              <tr>
                <th>Characteristic</th>
                <th>BC group n = 100</th>
                <th>HCs n = 100</th>
                <th>P-Value</th>
              </tr>
            </thead>
            <tbody>
              <tr>
                <td>Age (years)</td>
                <td/>
                <td/>
                <td/>
              </tr>
              <tr>
                <td>Mean &#x00B1;SD</td>
                <td>54.86 &#x00B1;10.77</td>
                <td>54.61 &#x00B1;9.53</td>
                <td rowspan="2" style="vertical-align:middle; text-align:center;">0.862 I <sup>NS</sup></td>
              </tr>
              <tr>
                <td>Range</td>
                <td>27 -75</td>
                <td>30 -75</td>
              </tr>
            </tbody>
          </table>
          <table-wrap-foot>
            <fn>
              <p>NS, not significant; n, number of cases; I, independent samples t-test</p>
            </fn>
          </table-wrap-foot>
        </table-wrap>
        <p id="P17">Most patients (84 %) had grade I or grade II disease, whereas 16 % had grade III or grade IV disease. The majority of patients (74 %) had T1 or T2 stage, 10 % of whom had T3 or T4 stage and in 16 % of cases the information about T stage was lacking. In most cases, the N stage was that of N1, accounting for 54 %, followed by N2 stage, which was seen in 24 %, followed by N3 stage, which was reported in 12 %, and lastly no lymph node involvement (N0) was observed in 10 %. No metastasis was the predominant finding, as it was reported in 70 %, whereas distant metastasis was seen in 4 %; however, information about metastasis was lacking in 26 %. The common type was invasive ductal carcinoma, which was seen in 84 %, whereas invasive lobular carcinomas were seen in 16 %. The results showed that half of the cases involved the left side, 46% the right side, and 4% showed bilateral involvement. Positive immunohistochemical expression of estrogen receptors (ER) was observed in 58 %, the expression of progesterone receptors (PR) was observed in 44 % and Her2 neu was reported in 36 %.</p>
        <p id="P18">The classification of patients with breast carcinoma based on immunohistochemical profiles is shown in Table 3. Luminal B (ER/PR+, Her2+) was seen in 28 %, luminal A (ER/PR+, Her2-) was seen in 44 %, her2+ (ER/PR&#x2212;, Her2+) was seen in 8 %, and triple negative (ER/PR&#x2212;, Her2-) was observed in 20 % of cases.</p>
        <table-wrap id="T3" position="float">
          <label>Table 3</label>
          <caption>
            <title>Classification of patients with breast carcinoma based on immunohistochemical profile</title>
          </caption>
          <table>
            <thead>
              <tr>
                <th>Subtype</th>
                <th>ER</th>
                <th>PR</th>
                <th>Her2neu</th>
                <th>Number (%)</th>
              </tr>
            </thead>
            <tbody>
              <tr>
                <td rowspan="4" style="vertical-align:middle;">Luminal B (ER/PR+, Her2+)</td>
                <td>+</td>
                <td>+</td>
                <td>+</td>
                <td>10 (10 %)</td>
              </tr>
              <tr>
                <td>+</td>
                <td>-</td>
                <td>+</td>
                <td>16 (16 %)</td>
              </tr>
              <tr>
                <td>-</td>
                <td>+</td>
                <td>+</td>
                <td>2 (2 %)</td>
              </tr>
              <tr>
                <td colspan="3" style="text-align:right; font-weight:bold;">Total</td>
                <td style="font-weight:bold;">28 (28 %)</td>
              </tr>
              <tr>
                <td rowspan="4" style="vertical-align:middle;">Luminal A (ER/PR+, Her2-)</td>
                <td>+</td>
                <td>+</td>
                <td>-</td>
                <td>20 (20 %)</td>
              </tr>
              <tr>
                <td>+</td>
                <td>-</td>
                <td>-</td>
                <td>12 (12 %)</td>
              </tr>
              <tr>
                <td>-</td>
                <td>+</td>
                <td>-</td>
                <td>12 (12 %)</td>
              </tr>
              <tr>
                <td colspan="3" style="text-align:right; font-weight:bold;">Total</td>
                <td style="font-weight:bold;">44 (44 %)</td>
              </tr>
              <tr>
                <td>Triple negative (ER/PR&#x2212;, Her2-)</td>
                <td>-</td>
                <td>-</td>
                <td>-</td>
                <td>20 (20 %)</td>
              </tr>
              <tr>
                <td>Her2+ (ER/PR&#x2212;, Her2+)</td>
                <td>-</td>
                <td>-</td>
                <td>+</td>
                <td>8 (8 %)</td>
              </tr>
            </tbody>
          </table>
          <table-wrap-foot>
            <fn>
              <p>PR, progesterone receptor; +, Positive; -: Negative; ER, estrogen receptor.</p>
            </fn>
          </table-wrap-foot>
        </table-wrap>
      </sec>
      <sec id="S14">
        <title>Comparison of serum markers between BC groups and HCs</title>
        <p id="P19">A comparison of serum markers between the BC and HCs groups is shown in Table 4. Serum levels of CEA (median (IQR)) were significantly higher in the BC group in comparison with HCs, 104.05 pg/ml versus 26.85 pg/ml, respectively (P&lt; 0.001) (Figure 1). Serum levels of resistin (RETN) were significantly higher in the BC group than in the HCs, 1.16 ng/ml versus 0.41 ng/ml, respectively (P&lt; 0.001); Figure 2).</p>
        <table-wrap id="T4" position="float">
          <label>Table 4</label>
          <caption>
            <title>Comparison of serum markers between BC groups and HCs</title>
          </caption>
          <table>
            <thead>
              <tr>
                <th>Characteristic</th>
                <th>BC group n = 100</th>
                <th>HCs n = 100</th>
                <th>P</th>
              </tr>
            </thead>
            <tbody>
              <tr>
                <td>CEA (pg/mL)</td>
                <td/>
                <td/>
                <td rowspan="3" style="vertical-align:middle; text-align:center;">&lt;0.001 <sup>M ***</sup></td>
              </tr>
              <tr>
                <td>Median (IQR)</td>
                <td>104.05 (261.24)</td>
                <td>26.85 (16.47)</td>
              </tr>
              <tr>
                <td>Range</td>
                <td>0.48 -559.76</td>
                <td>10.91 -191.67</td>
              </tr>
              <tr>
                <td>RETN (ng/mL)</td>
                <td/>
                <td/>
                <td rowspan="3" style="vertical-align:middle; text-align:center;">&lt;0.001 <sup>M ***</sup></td>
              </tr>
              <tr>
                <td>Median (IQR)</td>
                <td>1.16 (1.46)</td>
                <td>0.41 (0.99)</td>
              </tr>
              <tr>
                <td>Range</td>
                <td>0.06 -6.38</td>
                <td>0.02 -1.7</td>
              </tr>
            </tbody>
          </table>
          <table-wrap-foot>
            <fn>
              <p>***: significant at P &#x2264; 0.001; M: Mann Whitney U test; CEA: carcinoembryonic antigen; RETN: resistin; n: number of cases; IQR: inter-quartile range</p>
            </fn>
          </table-wrap-foot>
        </table-wrap>
        <fig id="F1">
          <label>Figure 1</label>
          <caption>
            <p>Plot box representing comparisons of serum CEA between BC group and HCs</p>
          </caption>
          <graphic xlink:href="2383-0433-12-02-171-g001.jpg">
            <alt-text>Figure 1</alt-text>
          </graphic>
        </fig>
        <fig id="F2">
          <label>Figure 2</label>
          <caption>
            <p>Plot box representing comparisons of serum RETN between BC group and HCs</p>
          </caption>
          <graphic xlink:href="2383-0433-12-02-171-g002.jpg">
            <alt-text>Figure 2</alt-text>
          </graphic>
        </fig>
        <p id="P20">The findings of the receiver operating characteristic (ROC) curve analysis are shown in Table 6 and Figures 3 and 4, in which the diagnostic capacity of blood CEA and serum RETN in the case of BC is assessed. With an area under the curve (AUC) of &gt; 0.7 (0.762) and a cutoff value of &gt;35.71 (pg/ml), CEA demonstrated a satisfactory degree of accuracy of 76.2%, sensitivity of 69.7%, and specificity of 79.2%. With a sensitivity of 89.9% and a specificity of 51.5%, RETN had an excellent accuracy level of 74.2% and a cutoff value of &gt;0.41 (ng/ml). The area under the curve (AUC) was &gt; 0.7 (0.742).</p>
        <table-wrap id="T6" position="float">
          <label>Table 6</label>
          <caption>
            <title>The diagnostic potential of serum CEA and serum RETN in case of BC</title>
          </caption>
          <table>
            <thead>
              <tr>
                <th>Characteristic</th>
                <th>CEA</th>
                <th>RETN</th>
              </tr>
            </thead>
            <tbody>
              <tr>
                <td>Cutoff</td>
                <td>&gt;35.71</td>
                <td>&gt; 0.41</td>
              </tr>
              <tr>
                <td>AUC (95 % CI)</td>
                <td>0.762 (0.697 to 0.820)</td>
                <td>0.742 (0.676 to 0.801)</td>
              </tr>
              <tr>
                <td>P</td>
                <td>&lt;0.001*</td>
                <td>&lt;0.001*</td>
              </tr>
              <tr>
                <td>Sensitivity %</td>
                <td>69.7</td>
                <td>89.9</td>
              </tr>
              <tr>
                <td>Specificity %</td>
                <td>79.2</td>
                <td>51.5</td>
              </tr>
              <tr>
                <td>Accuracy %</td>
                <td>76.2</td>
                <td>74.2</td>
              </tr>
            </tbody>
          </table>
          <table-wrap-foot>
            <fn>
              <p>*: significant at P&#x2264;0.001; CEA: carcinoembryonic antigen; RETN: resistin.</p>
            </fn>
          </table-wrap-foot>
        </table-wrap>
        <fig id="F3">
          <label>Figure 3</label>
          <caption>
            <p>Curve analysis of ROC to detect the value of cutoff of sera CEA level that can predict a diagnosis of breast carcinoma with best accuracy</p>
          </caption>
          <graphic xlink:href="2383-0433-12-02-171-g003.jpg">
            <alt-text>Figure 3</alt-text>
          </graphic>
        </fig>
        <fig id="F4">
          <label>Figure 4</label>
          <caption>
            <p>Curve analysis of ROC to detect the value of cutoff of sera RETN level that can predict a diagnosis of breast carcinoma with best accuracy</p>
          </caption>
          <graphic xlink:href="2383-0433-12-02-171-g004.jpg">
            <alt-text>Figure 4</alt-text>
          </graphic>
        </fig>
        <p id="P21">In this study, CEA serum levels in patients with BC averaged 104.05 pg/ml which was significantly higher in the BC group than in the HCs group (Table 4). In this study, with respect to CEA, there was a significant positive correlation with age and a significant negative correlation with tumor location (higher levels with right-sided lesions and lower levels with left-sided lesions), as shown in Table 5. With respect to CEA, there was a significant positive correlation with age and a significant negative correlation with tumor location (higher levels with right-sided lesions and lower levels with left-sided lesions).</p>
        <table-wrap id="T5" position="float">
          <label>Table 5</label>
          <caption>
            <title>Correlations of CEA, RETN, miR-373 and miR-425 to clinicopathological characteristics of patients with breast carcinoma</title>
          </caption>
          <table>
            <thead>
              <tr>
                <th rowspan="2" style="vertical-align:middle;">Parameter</th>
                <th colspan="2">CEA (pg/ml)</th>
                <th colspan="2">RETN (ng/ml)</th>
                <th colspan="2">miR-373 fold change</th>
                <th colspan="2">miR-425 fold change</th>
              </tr>
              <tr>
                <th>p</th>
                <th>r</th>
                <th>p</th>
                <th>r</th>
                <th>p</th>
                <th>r</th>
                <th>p</th>
                <th>r</th>
              </tr>
            </thead>
            <tbody>
              <tr>
                <td>Age</td>
                <td>0.024 *</td>
                <td>0.226</td>
                <td>0.351</td>
                <td>0.094</td>
                <td>0.850</td>
                <td>0.019</td>
                <td>0.113</td>
                <td>-0.160</td>
              </tr>
              <tr>
                <td>Grade</td>
                <td>0.074</td>
                <td>0.180</td>
                <td>0.003 **</td>
                <td>0.293</td>
                <td>0.133</td>
                <td>-0.151</td>
                <td>0.709</td>
                <td>-0.038</td>
              </tr>
              <tr>
                <td>Tumor size</td>
                <td>0.075</td>
                <td>-0.179</td>
                <td>0.350</td>
                <td>-0.094</td>
                <td>0.742</td>
                <td>0.033</td>
                <td>0.256</td>
                <td>0.115</td>
              </tr>
              <tr>
                <td>Lymph node</td>
                <td>0.994</td>
                <td>0.000</td>
                <td>0.301</td>
                <td>-0.105</td>
                <td>0.018 *</td>
                <td>-0.236</td>
                <td>0.961</td>
                <td>-0.005</td>
              </tr>
              <tr>
                <td>Metastasis</td>
                <td>0.559</td>
                <td>0.059</td>
                <td>0.544</td>
                <td>0.061</td>
                <td>0.024 *</td>
                <td>-0.226</td>
                <td>0.439</td>
                <td>-0.078</td>
              </tr>
              <tr>
                <td>Family history</td>
                <td>0.190</td>
                <td>-0.132</td>
                <td>0.001 **</td>
                <td>-0.313</td>
                <td>0.597</td>
                <td>0.053</td>
                <td>0.860</td>
                <td>-0.018</td>
              </tr>
              <tr>
                <td>Type of BC</td>
                <td>0.177</td>
                <td>0.136</td>
                <td>0.867</td>
                <td>-0.017</td>
                <td>0.390</td>
                <td>0.087</td>
                <td>0.312</td>
                <td>-0.102</td>
              </tr>
              <tr>
                <td>Location of BC (1= Left, 2= Right, 3= Bilateral)</td>
                <td>0.001 ***</td>
                <td>-0.326</td>
                <td>0.070</td>
                <td>-0.182</td>
                <td>0.570</td>
                <td>-0.057</td>
                <td>0.590</td>
                <td>0.055</td>
              </tr>
              <tr>
                <td>ER</td>
                <td>0.934</td>
                <td>0.008</td>
                <td>0.047 *</td>
                <td>0.199</td>
                <td>0.002 **</td>
                <td>0.305</td>
                <td>0.297</td>
                <td>-0.105</td>
              </tr>
              <tr>
                <td>PR</td>
                <td>0.234</td>
                <td>-0.120</td>
                <td>0.090</td>
                <td>-0.170</td>
                <td>0.659</td>
                <td>-0.045</td>
                <td>0.815</td>
                <td>-0.024</td>
              </tr>
              <tr>
                <td>HER2</td>
                <td>0.271</td>
                <td>-0.111</td>
                <td>1.000</td>
                <td>0.000</td>
                <td>0.512</td>
                <td>0.066</td>
                <td>0.921</td>
                <td>-0.010</td>
              </tr>
            </tbody>
          </table>
          <table-wrap-foot>
            <fn>
              <p>***: significant at P&#x2264; 0.001; CEA: carcinoembryonic antigen; ER: estrogen receptors; PR: progesterone; RETN: resistin; BC: BC; *: significant at P&#x2264; 0.05; **: significant at P&#x2264; 0.01;</p>
            </fn>
          </table-wrap-foot>
        </table-wrap>
        <p id="P22">With respect to RETN, there was a significant positive correlation between tumor grade and ER expression, and a significant negative correlation with family history.</p>
        <p id="P23">Regarding miR-373, there was a significant positive correlation with ER expression and a significant negative correlation with lymph node involvement and the presence of metastasis (Table 5).</p>
      </sec>
      <sec id="S15">
        <title>Comparison of gene expression of miR-373 and miR-425 between BC groups and HCs</title>
        <p id="P24">In contrast to HCs, the BC group showed considerably greater levels of miR-373 expression, with a median (IQR) fold change of 3.54 (8.23) vs 1 fold change (P&lt;0.001), as seen in Figure 5. Figure 6 shows that there was a considerably greater expression level of miR-425 in the BC group than in the HCs, with a median (IQR) of 4.80 (10.22) fold change and a 1 fold change, respectively (P&lt; 0.001).</p>
        <fig id="F5">
          <label>Figure 5</label>
          <caption>
            <p>Plot box representing comparisons of miR-373 expression between BC group and HCs</p>
          </caption>
          <graphic xlink:href="2383-0433-12-02-171-g005.jpg">
            <alt-text>Figure 5</alt-text>
          </graphic>
        </fig>
        <fig id="F6">
          <label>Figure 6</label>
          <caption>
            <p>Plot box representing comparisons of miR-425 expression between BC group and HCs</p>
          </caption>
          <graphic xlink:href="2383-0433-12-02-171-g006.jpg">
            <alt-text>Figure 6</alt-text>
          </graphic>
        </fig>
      </sec>
    </sec>
    <sec sec-type="discussion" id="S16">
      <title>Discussion</title>
      <p id="P25">There were different results in this study regarding the presence of luminal B, luminal A, her2+, ER/PR&#x2212;, and triple negative. Luminal B was seen in 28% of patients, luminal A in 44%, her2+ in 8%, and triple negative in 20%. In 2024, Mohsin and Mohamad (2024) found that 46.67 percent of hormone receptors were positive, 42.22 percent were negative, 62.2 percent were negative for HER2, and 46.67 percent of all molecular subtypes belonged to luminal A and B.<xref rid="R16" ref-type="bibr"><sup>16</sup></xref></p>
      <p id="P26">The CEA level was 104.05 (261.24) in the control compared to 26.85 (16.47) in the HCs group, which was close to a study which found that metastatic and recurring BCs were associated with significantly higher blood CEA levels in patients.<xref rid="R17" ref-type="bibr"><sup>17</sup></xref> Serum CEA positive rates have been reported in investigations ranging from 36% to 70%. These heightened levels are recognized to be positively correlated with tumor burden, tumor grade, and metastatic site, consequently leading to reduced overall survival (OS) and progression-free survival.<xref rid="R18" ref-type="bibr"><sup>18</sup></xref></p>
      <p id="P27">The recommendation for serial monitoring of tumor markers is not supported in asymptomatic individuals after BC treatment.<xref rid="R19" ref-type="bibr"><sup>19</sup></xref>,<xref rid="R20" ref-type="bibr"><sup>20</sup></xref> The commonly used serum tumor markers for BC are CA15-3 and CEA.<xref rid="R21" ref-type="bibr"><sup>21</sup></xref>,<xref rid="R22" ref-type="bibr"><sup>22</sup></xref>. Therefore, the estimation of serum CEA levels can be considered an adjunctive method for evaluating treatment response, monitoring progress, and obtaining prognostic insights. Nevertheless, the clinical applicability of these markers remains uncertain because of conflicting outcomes.<xref rid="R23" ref-type="bibr"><sup>23</sup></xref>,<xref rid="R24" ref-type="bibr"><sup>24</sup></xref></p>
      <p id="P28">In the present study, Serum levels of RETN were significantly higher in BC group in comparison with HCs. Our findings are in agreement with the results of several previous articles.<xref rid="R25" ref-type="bibr"><sup>25</sup></xref>&#x2013;<xref rid="R27" ref-type="bibr"><sup>27</sup></xref> The study conducted by Hou et al. (2007) collected blood samples from 80 recently diagnosed BC patients who had received histological confirmation, along with 50 age-matched healthy controls.<xref rid="R25" ref-type="bibr"><sup>25</sup></xref> The findings indicated that the serum concentrations of resistin were elevated in BC patients compared to healthy controls, with levels of (26.35&#x00B1;5.36) &#x03BC;g/L versus (23.32&#x00B1;4.75)&#x03BC;g/L, showing a statistically significant difference (P=0.000). Dalamaga et al. observed that the average serum resistin levels were notably higher in the cases than in HCs (P&lt;0.001).<xref rid="R26" ref-type="bibr"><sup>26</sup></xref> Furthermore, in a study conducted by Assiri et al., a cohort of 82 newly diagnosed BC patients who had histological confirmation and 68 healthy controls matched in terms of age and BMI were included.<xref rid="R27" ref-type="bibr"><sup>27</sup></xref> The results revealed significantly elevated levels of resistin in BC patients compared with their respective control counterparts. However, the results of Georgiou et al., were inconsistent with those of the present study as they reported that women with breast carcinoma exhibited resistin levels (6.11&#x00B1;4.49ng/ml), whereas control subjects showed a mean level of 6.14&#x00B1;1.83ng/ml and according to the statistical analysis, there was no notable variation in serum resistin levels between the groups (P=0.064).<xref rid="R28" ref-type="bibr"><sup>28</sup></xref></p>
      <p id="P29">Consistent with the results of the present study, ROC curve analysis showed that resistin had poor diagnostic performance, with a total accuracy level of 72%.<xref rid="R26" ref-type="bibr"><sup>26</sup></xref> According to a number of studies, resistin is essential for cancer cell metabolic regulation, angiogenesis, inflammation, proliferation, and metastasis.<xref rid="R29" ref-type="bibr"><sup>29</sup></xref>. Resistin may serve as a biomarker for BC, indicating an advanced disease stage and inflammatory state, even if its diagnostic performance was poor according to ROC curve study [0.72, 95% CI: 0.64-0.79].<xref rid="R26" ref-type="bibr"><sup>26</sup></xref> Research has identified resistin as a possible biomarker for cancer diagnosis and prognosis.<xref rid="R25" ref-type="bibr"><sup>25</sup></xref> Researchers have found that resistin levels were higher in BC patients (80 total) than in healthy controls (50 total). Additionally, resistin levels have been shown to be higher in individuals with lymph node metastasis than in those without it.<xref rid="R30" ref-type="bibr"><sup>30</sup></xref> Age, menopausal status, blood glucose, body mass index (BMI), and adiponectin levels had no effect on the association between resistin levels and an increased risk of BC. The study conducted by Dalamaga et al. and Assiri et al. found a strong association between tumors and inflammatory markers, tumor size, malignancy grade, stage, and lymph node invasion.<xref rid="R26" ref-type="bibr"><sup>26</sup></xref>,<xref rid="R27" ref-type="bibr"><sup>27</sup></xref> Hou et al. documented that serum concentrations of resistin exhibited notable discrepancies between individuals afflicted with lymph node metastasis and those devoid of such metastasis.<xref rid="R25" ref-type="bibr"><sup>25</sup></xref> Also, Dalamaga et al. noted in their study that resistin was significantly correlated with various parameters in BC patients, including cancer stage, tumor dimensions, grade, and lymph node infiltration, while exhibiting no apparent relationship with hormone receptor status.<xref rid="R26" ref-type="bibr"><sup>26</sup></xref> In addition, according to Assiri et al. (2015), histological grading, tumor size, lymph node metastasis, and TNM staging were positively correlated with serum resistin levels.<xref rid="R27" ref-type="bibr"><sup>27</sup></xref> Our study found a strong negative link between family medical history and a strong positive relationship between RETN, tumor grade, and ER expression. Research suggests that microRNAs play important roles in a variety of cellular processes, and patterns of miRNA expression might be useful indicators for the diagnosis of different cancers and patient outcomes. Additionally, multiple studies have shown that miRNA-373 has oncogenic functions in human cancers by targeting certain genes.<xref rid="R17" ref-type="bibr"><sup>17</sup></xref>,<xref rid="R24" ref-type="bibr"><sup>24</sup></xref>,<xref rid="R31" ref-type="bibr"><sup>31</sup></xref>,<xref rid="R32" ref-type="bibr"><sup>32</sup></xref> Nevertheless, the functions of miRNA-373 in BC have been debated by Wei and Wang, who motivated us to examine the role of miRNA-373 in BC.<xref rid="R33" ref-type="bibr"><sup>33</sup></xref></p>
      <p id="P30">The current study demonstrated a notable increase in the expression levels of miR-373 among patients compared to HCs. This observation aligns with the results reported by Bakr et al., who noted a heightened presence of miRNA-373 in BC patients and those with benign breast lesions, in contrast to reduced levels in the HCs. These results suggest that miRNA-373 could serve as a valuable molecular biomarker for the early detection and diagnosis of BC, facilitating the differentiation between cancerous and non-cancerous instances.<xref rid="R34" ref-type="bibr"><sup>34</sup></xref></p>
      <p id="P31">Interestingly, these findings contradict the observations of Bakr et al., who identified a significant link between the expression level of miRNA-373 and adverse prognostic factors in BC.<xref rid="R34" ref-type="bibr"><sup>34</sup></xref> In addition, Raheem et al. found elevated levels of MiRNA-373 in BC pataints (-12.20 &#x00B1; 1.11). miRNA-373, which is unique to human embryonic stem cells (ESCs), exerts novel oncogenic effects by regulating the growth and formation of tumors in primary human cells containing oncogenic factors such as rat sarcoma (RAS) and wild-type p53.<xref rid="R33" ref-type="bibr"><sup>33</sup></xref> Its distinctive expression patterns and strong relationship with cancer cell invasion and metastasis make it a promising candidate as a potential biomarker for BC, as suggested by findings from studies on cancer cells and tissue samples.<xref rid="R35" ref-type="bibr"><sup>35</sup></xref>,<xref rid="R36" ref-type="bibr"><sup>36</sup></xref> This study examined miR-425 expression levels, which were much higher in patients than in healthy controls. The role of miR-425 in the development of certain cancers was suggested by Zhang et al.<xref rid="R10" ref-type="bibr"><sup>10</sup></xref> The results of this study are in agreement with those of Xiao et al., who used RT-qPCR to show that miR-425 expression was higher in BC tissues than in neighboring tissues and cell lines. In addition, compared to human mammary epithelial cells, BC cell lines exhibit higher expressions of miR-425. To our knowledge, our study is the first to compare miR-425 expression levels in healthy individuals with BC patients in Iraqi women. The significant increase in miR-425 levels observed in our study highlights the promising role of this biomarker as a non-invasive method for detecting early stage.<xref rid="R37" ref-type="bibr"><sup>37</sup></xref></p>
      <p id="P32">While miR-425-5p's involvement in the oncogenesis of other neoplasms has been established, the exact nature of its function in BC remains unknown.<xref rid="R10" ref-type="bibr"><sup>10</sup></xref> This study found that miR-425-5p is greatly upregulated in BC cells and is associated with poor prognosis in BC patients. Zhang et al. (2020) found that miR-425-5p was significantly upregulated in BC cells and predicted a poor prognosis in BC patients.<xref rid="R38" ref-type="bibr"><sup>38</sup></xref> BC cell growth was greatly enhanced by an increase in miR-425-5p levels. Following this, researchers found that cyclin-dependent kinases (CDK4), Cyclin D3 (cyclin D3), and miR-425-5p protein levels were all upregulated. Conversely, cell cycle arrest in the G0/G1 phase was the end outcome of miR-425-5p suppression, which led to reduced expression of these genes.<xref rid="R10" ref-type="bibr"><sup>10</sup></xref> From a mechanistic standpoint, silencing miR-425-5p had the opposite effect as overexpression, leading to increased phosphorylation of phosphoinositide 3-kinase- regulatory subunit -p85 (PI3K- p85) and protein kinase B (AKT). Additionally, miR-425-5p binds to the 3'UTR of Phosphatase and tensin homolog deleted on chromosome 10 (PTEN) mRNA, which in turn reduces the production of PTEN in BC cells, both at the mRNA and protein levels. In summary, the results demonstrate that miR-425-5p is involved in BC carcinogenesis via PI3K/AKT pathway activation, implying that it may be a therapeutic target for BC. This study provides important insights into the expression of miR-373, miR-425, and CEA, and serum levels. These findings may be more applicable to the specific patient population and healthcare setting studied, but they lay the groundwork for further research. Larger multicenter studies with more diverse patient populations are essential to confirm and extend these results. Future research should be conducted by increasing the sample size, including more diverse demographic groups, and incorporating multi-center designs. This would enhance the external validity of the findings and provide a clearer picture of how the results can be applied to different settings and populations.</p>
    </sec>
    <sec sec-type="conclusions" id="S17">
      <title>Conclusion</title>
      <p id="P33">The biomarkers CEA, RETN, miR-373, and miR-425 were identified as promising candidates for enhancing the diagnostic workup, prognosis, and therapy of BC. CEA and RETN are established markers that aid in the early detection and monitoring of tumor progression, whereas miR-373 and miR-425 are involved in critical processes such as tumor metastasis, EMT, and chemoresistance. Their potential to regulate CD44 expression highlights their roles in inhibiting cancer cell invasion and reducing metastasis.</p>
    </sec>
  </body>
  <back>
    <ack id="S18">
      <title>Acknowledgements</title>
      <p id="P34">We are truly grateful to the patients who supplied samples for our study despite their debilitating medical conditions. The staff members at Al-Amal Hospital made considerable efforts to make the process of collecting samples as simple as possible. We thank the laboratories of the Institute for Genetic Engineering and Biotechnology for Postgraduate Studies/ University of Baghdad for their contribution to accomplishing the practical part of this study.</p>
    </ack>
    <sec id="S19">
      <title>Ethical considerations</title>
      <p id="P35">Each patient and control participant provided descriptive information to complete a questionnaire designed for this purpose. The study was conducted based on the ethics code of Al-Amal Hospital in the Medical City in Baghdad, Iraq, under the document number (11581) on (19/03/2023).</p>
    </sec>
    <sec sec-type="data-availability" id="S20">
      <title>Data availability</title>
      <p id="P36">The datasets used and analyzed during the current study are available from the corresponding author on reasonable request.</p>
    </sec>
    <ref-list>
      <title>References</title>
      <ref id="R1">
        <label>1</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Abdallah</surname><given-names>M</given-names></name>
            <name><surname>Aziz</surname><given-names>IH</given-names></name>
            <name><surname>Alsammarraie</surname><given-names>AZ</given-names></name>
          </person-group>.
          <article-title>Assessment of miRNA&#x2010;10b Expression Levels as a Potential Precursor to Metastasis in Localized and Locally Advanced/Metastatic Breast Cancer among Iraqi Patients</article-title>.
          <source>Int J Breast Cancer</source>.
          <year>2024</year>;<volume>2024</volume>(<issue>1</issue>):<fpage>2408355</fpage>.
        </mixed-citation>
      </ref>
      <ref id="R2">
        <label>2</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Hussain</surname><given-names>AM</given-names></name>
            <name><surname>Ali</surname><given-names>AH</given-names></name>
            <name><surname>Mohammed</surname><given-names>HL</given-names></name>
          </person-group>.
          <article-title>Correlation between serum and tissue markers in breast cancer Iraqi patients</article-title>.
          <source>Baghdad Sci J</source>.
          <year>2022</year>;<volume>19</volume>(<issue>3</issue>):<fpage>501</fpage>.
        </mixed-citation>
      </ref>
      <ref id="R3">
        <label>3</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Sahan</surname><given-names>KA</given-names></name>
            <name><surname>Aziz</surname><given-names>IH</given-names></name>
            <name><surname>Dawood</surname><given-names>SN</given-names></name>
            <name><surname>Al Qazzaz</surname><given-names>H</given-names></name>
          </person-group>.
          <article-title>The role of resistin gene polymorphism in Iraqi breast cancer patients</article-title>.
          <source>Biomedicine</source>.
          <year>2022</year>;<volume>42</volume>(<issue>6</issue>):<fpage>1296</fpage>-<lpage>1300</lpage>.
        </mixed-citation>
      </ref>
      <ref id="R4">
        <label>4</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Siegel</surname><given-names>RL</given-names></name>
            <name><surname>Miller</surname><given-names>KD</given-names></name>
            <name><surname>Fuchs</surname><given-names>HE</given-names></name>
            <name><surname>Jemal</surname><given-names>A</given-names></name>
          </person-group>.
          <article-title>Cancer statistics, 2022</article-title>.
          <source>CA Cancer J Clin</source>.
          <year>2022</year>;<volume>72</volume>(<issue>1</issue>):<fpage>7</fpage>-<lpage>33</lpage>.
          doi:<pub-id pub-id-type="doi">10.3322/caac.21708</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R5">
        <label>5</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Abbas</surname><given-names>R</given-names></name>
            <name><surname>Aziz</surname><given-names>I</given-names></name>
          </person-group>.
          <article-title>A study comparing the oncogenic microRNA-21-5p and the CA15-3 characteristics as an effective tumor marker in breast cancer patients from Iraq</article-title>.
          <source>Bionatura</source>.
          <year>2022</year>;<volume>7</volume>:<fpage>1</fpage>-<lpage>7</lpage>.
          doi:<pub-id pub-id-type="doi">10.21931/RB/2022.07.04.10</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R6">
        <label>6</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Bodaghi</surname><given-names>A</given-names></name>
            <name><surname>Fattahi</surname><given-names>N</given-names></name>
            <name><surname>Ramazani</surname><given-names>A</given-names></name>
          </person-group>.
          <article-title>Biomarkers: Promising and valuable tools towards diagnosis, prognosis and treatment of Covid-19 and other diseases</article-title>.
          <source>Heliyon</source>.
          <year>2023</year>;<volume>9</volume>(<issue>2</issue>).
        </mixed-citation>
      </ref>
      <ref id="R7">
        <label>7</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Abed</surname><given-names>RM</given-names></name>
            <name><surname>Yaaqoob</surname><given-names>LA</given-names></name>
          </person-group>.
          <article-title>Novel single nucleotide polymorphism (rs1600485907) of IL-41 gene associated with systemic lupus erythematous</article-title>.
          <source>Asia-Pacific J Mol Biol Biotechnol</source>.
          <year>2023</year>;<volume>31</volume>(<issue>4</issue>):<fpage>1</fpage>-<lpage>8</lpage>.
        </mixed-citation>
      </ref>
      <ref id="R8">
        <label>8</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>AL-saqabi</surname><given-names>ANI</given-names></name>
            <name><surname>Aziz</surname><given-names>IH</given-names></name>
          </person-group>.
          <article-title>The expression miRNA-195 in a sample of Iraqi breast cancer pa-tients</article-title>.
          <source>Bionatura</source>.
          <year>2023</year>;<volume>8</volume>(<issue>3</issue>):<fpage>1</fpage>-<lpage>6</lpage>.
        </mixed-citation>
      </ref>
      <ref id="R9">
        <label>9</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Salih</surname><given-names>AM</given-names></name>
            <name><surname>Aziz</surname><given-names>IH</given-names></name>
            <name><surname>Mohsin</surname><given-names>FY</given-names></name>
          </person-group>.
          <article-title>Role of miRNA 199a-5p Expression in Iraqi Women with Breast Cancer</article-title>.
          <source>Al-Rafidain J Med Sci (ISSN 2789-3219)</source>.
          <year>2023</year>;<volume>5</volume>(<issue>1S</issue>):<fpage>S94</fpage>-<lpage>S99</lpage>.
        </mixed-citation>
      </ref>
      <ref id="R10">
        <label>10</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Zhang</surname><given-names>Y</given-names></name>
            <name><surname>Zhao</surname><given-names>J</given-names></name>
            <name><surname>Wang</surname><given-names>Y</given-names></name>
            <etal/>
          </person-group>.
          <article-title>Changes of tumor markers in patients with breast cancer during postoperative adjuvant chemotherapy</article-title>.
          <source>Dis Markers</source>.
          <year>2022</year>;<volume>2022</volume>(<issue>1</issue>):<fpage>7739777</fpage>.
        </mixed-citation>
      </ref>
      <ref id="R11">
        <label>11</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Anoop</surname><given-names>TM</given-names></name>
            <name><surname>Soman</surname><given-names>S</given-names></name>
            <name><surname>Chacko</surname><given-names>S</given-names></name>
            <name><surname>Mathew</surname><given-names>M</given-names></name>
          </person-group>.
          <article-title>Significance of serum carcinoembryonic antigen in metastatic breast cancer patients: A prospective study</article-title>.
          <source>World J Clin Oncol</source>.
          <year>2022</year>;<volume>13</volume>(<issue>6</issue>):<fpage>529</fpage>.
        </mixed-citation>
      </ref>
      <ref id="R12">
        <label>12</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Sahan</surname><given-names>KA</given-names></name>
            <name><surname>Aziz</surname><given-names>IH</given-names></name>
            <name><surname>Dawood</surname><given-names>SN</given-names></name>
            <name><surname>Razzaq</surname><given-names>SSA</given-names></name>
          </person-group>.
          <article-title>Evaluation of miR-146 and miR-196 as potential biomarkers in a sample of Iraqi breast cancer patients</article-title>.
          <source>Bionatura</source>.
          <year>2023</year>;<volume>8</volume>(<issue>2</issue>):<fpage>1</fpage>-<lpage>2</lpage>.
        </mixed-citation>
      </ref>
      <ref id="R13">
        <label>13</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Shin</surname><given-names>JH</given-names></name>
            <name><surname>Park</surname><given-names>S</given-names></name>
            <name><surname>Cho</surname><given-names>H</given-names></name>
            <name><surname>Kim</surname><given-names>JH</given-names></name>
            <name><surname>Choi</surname><given-names>H</given-names></name>
          </person-group>.
          <article-title>Adipokine human Resistin promotes obesity-associated inflammatory intervertebral disc degeneration via pro-inflammatory cytokine cascade activation</article-title>.
          <source>Sci Rep</source>.
          <year>2022</year>;<volume>12</volume>(<issue>1</issue>):<fpage>8936</fpage>.
        </mixed-citation>
      </ref>
      <ref id="R14">
        <label>14</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Wang</surname><given-names>CH</given-names></name>
            <name><surname>Wang</surname><given-names>PJ</given-names></name>
            <name><surname>Hsieh</surname><given-names>YC</given-names></name>
            <etal/>
          </person-group>.
          <article-title>Resistin facilitates breast cancer progression via TLR4-mediated induction of mesenchymal phenotypes and stemness properties</article-title>.
          <source>Oncogene</source>.
          <year>2018</year>;<volume>37</volume>(<issue>5</issue>):<fpage>589</fpage>-<lpage>600</lpage>.
        </mixed-citation>
      </ref>
      <ref id="R15">
        <label>15</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Lee</surname><given-names>JO</given-names></name>
            <name><surname>Kim</surname><given-names>N</given-names></name>
            <name><surname>Lee</surname><given-names>HJ</given-names></name>
            <etal/>
          </person-group>.
          <article-title>Resistin, a fat-derived secretory factor, promotes metastasis of MDA-MB-231 human breast cancer cells through ERM activation</article-title>.
          <source>Sci Rep</source>.
          <year>2016</year>;<volume>6</volume>(<issue>1</issue>):<fpage>18923</fpage>.
        </mixed-citation>
      </ref>
      <ref id="R16">
        <label>16</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Mohsin</surname><given-names>RN</given-names></name>
            <name><surname>Mohamad</surname><given-names>BJ</given-names></name>
          </person-group>.
          <article-title>Clinical and Histopathological Features of Breast Cancer in Iraqi Patients between 2018-2021</article-title>.
          <source>Iraqi J Sci</source>. Published online <year>2024</year>:<fpage>90</fpage>-<lpage>107</lpage>.
        </mixed-citation>
      </ref>
      <ref id="R17">
        <label>17</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Yang</surname><given-names>Y</given-names></name>
            <name><surname>Zhang</surname><given-names>H</given-names></name>
            <name><surname>Zhang</surname><given-names>M</given-names></name>
            <name><surname>Meng</surname><given-names>Q</given-names></name>
            <name><surname>Cai</surname><given-names>L</given-names></name>
            <name><surname>Zhang</surname><given-names>Q</given-names></name>
          </person-group>.
          <article-title>Elevation of serum CEA and CA15&#x2011;3 levels during antitumor therapy predicts poor therapeutic response in advanced breast cancer patients</article-title>.
          <source>Oncol Lett</source>.
          <year>2017</year>;<volume>14</volume>(<issue>6</issue>):<fpage>7549</fpage>-<lpage>7556</lpage>.
        </mixed-citation>
      </ref>
      <ref id="R18">
        <label>18</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Khushk</surname><given-names>M</given-names></name>
            <name><surname>Khan</surname><given-names>A</given-names></name>
            <name><surname>Rehman</surname><given-names>A</given-names></name>
            <etal/>
          </person-group>.
          <article-title>The role of tumor markers: carcinoembryonic antigen and cancer antigen 15-3 in patients with breast cancer</article-title>.
          <source>Cureus</source>.
          <year>2021</year>;<volume>13</volume>(<issue>7</issue>).
        </mixed-citation>
      </ref>
      <ref id="R19">
        <label>19</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Puglisi</surname><given-names>F</given-names></name>
            <name><surname>Fontanella</surname><given-names>C</given-names></name>
            <name><surname>Numico</surname><given-names>G</given-names></name>
            <etal/>
          </person-group>.
          <article-title>Follow-up of patients with early breast cancer: is it time to rewrite the story?</article-title>
          <source>Crit Rev Oncol Hematol</source>.
          <year>2014</year>;<volume>91</volume>(<issue>2</issue>):<fpage>130</fpage>-<lpage>141</lpage>.
        </mixed-citation>
      </ref>
      <ref id="R20">
        <label>20</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Rasmy</surname><given-names>A</given-names></name>
            <name><surname>Abozeed</surname><given-names>W</given-names></name>
            <name><surname>Elsamany</surname><given-names>S</given-names></name>
            <etal/>
          </person-group>.
          <article-title>Correlation of preoperative Ki67 and serum CA15. 3 levels with outcome in early breast cancers a multi institutional study</article-title>.
          <source>Asian Pacific J Cancer Prev</source>.
          <year>2016</year>;<volume>17</volume>(<issue>7</issue>):<fpage>3595</fpage>-<lpage>3600</lpage>.
        </mixed-citation>
      </ref>
      <ref id="R21">
        <label>21</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Bhindi</surname><given-names>B</given-names></name>
            <name><surname>Leibovich</surname><given-names>BC</given-names></name>
          </person-group>.
          <article-title>Re: Robotic versus Open Level I-II Inferior Vena Cava Thrombectomy: A Matched Group Comparative Analysis: L. Gu, X. Ma, Y. Gao, H. Li, X. Li, L. Chen, B. Wang, Y. Xie, Y. Fan and X. Zhang: J Urol 2017;: 198:: 1241&#x2013;1246</article-title>.
          <source>J Urol</source>.
          <year>2018</year>;<volume>199</volume>(<issue>5</issue>):<fpage>1351</fpage>-<lpage>1352</lpage>.
        </mixed-citation>
      </ref>
      <ref id="R22">
        <label>22</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Araz</surname><given-names>M</given-names></name>
            <name><surname>Beypinar</surname><given-names>I</given-names></name>
            <name><surname>Kazan</surname><given-names>S</given-names></name>
            <name><surname>Inci</surname><given-names>F</given-names></name>
            <name><surname>Celiker</surname><given-names>M</given-names></name>
            <name><surname>Uysal</surname><given-names>M</given-names></name>
          </person-group>.
          <article-title>Are preoperative serum CA15-3 levels different in breast cancer subgroups?</article-title>
          <source>Curr Probl Cancer</source>.
          <year>2019</year>;<volume>43</volume>(<issue>2</issue>):<fpage>115</fpage>-<lpage>122</lpage>.
        </mixed-citation>
      </ref>
      <ref id="R23">
        <label>23</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Nam</surname><given-names>S eun</given-names></name>
            <name><surname>Lim</surname><given-names>W</given-names></name>
            <name><surname>Jeong</surname><given-names>J</given-names></name>
            <etal/>
          </person-group>.
          <article-title>The prognostic significance of preoperative tumor marker (CEA, CA15-3) elevation in breast cancer patients: data from the Korean Breast Cancer Society Registry</article-title>.
          <source>Breast Cancer Res Treat</source>.
          <year>2019</year>;<volume>177</volume>:<fpage>669</fpage>-<lpage>678</lpage>.
        </mixed-citation>
      </ref>
      <ref id="R24">
        <label>24</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Li</surname><given-names>J</given-names></name>
            <name><surname>Liu</surname><given-names>L</given-names></name>
            <name><surname>Feng</surname><given-names>Z</given-names></name>
            <etal/>
          </person-group>.
          <article-title>Tumor markers CA15-3, CA125, CEA and breast cancer survival by molecular subtype: a cohort study</article-title>.
          <source>Breast Cancer</source>.
          <year>2020</year>;<volume>27</volume>:<fpage>621</fpage>-<lpage>630</lpage>.
        </mixed-citation>
      </ref>
      <ref id="R25">
        <label>25</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Hou</surname><given-names>W-K</given-names></name>
            <name><surname>Xu</surname><given-names>Y-X</given-names></name>
            <name><surname>Yu</surname><given-names>T</given-names></name>
            <etal/>
          </person-group>.
          <article-title>Adipocytokines and breast cancer risk</article-title>.
          <source>Chin Med J (Engl)</source>.
          <year>2007</year>;<volume>120</volume>(<issue>18</issue>):<fpage>1592</fpage>-<lpage>1596</lpage>.
        </mixed-citation>
      </ref>
      <ref id="R26">
        <label>26</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Dalamaga</surname><given-names>M</given-names></name>
            <name><surname>Sotiropoulos</surname><given-names>G</given-names></name>
            <name><surname>Karmaniolas</surname><given-names>K</given-names></name>
            <name><surname>Pelekanos</surname><given-names>N</given-names></name>
            <name><surname>Papadavid</surname><given-names>E</given-names></name>
            <name><surname>Lekka</surname><given-names>A</given-names></name>
          </person-group>.
          <article-title>Serum resistin: a biomarker of breast cancer in postmenopausal women? Association with clinicopathological characteristics, tumor markers, inflammatory and metabolic parameters</article-title>.
          <source>Clin Biochem</source>.
          <year>2013</year>;<volume>46</volume>(<issue>7-8</issue>):<fpage>584</fpage>-<lpage>590</lpage>.
        </mixed-citation>
      </ref>
      <ref id="R27">
        <label>27</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Assiri</surname><given-names>AMA</given-names></name>
            <name><surname>Kamel</surname><given-names>HFM</given-names></name>
            <name><surname>Hassanien</surname><given-names>MFR</given-names></name>
          </person-group>.
          <article-title>Resistin, visfatin, adiponectin, and leptin: risk of breast cancer in pre&#x2010;and postmenopausal saudi females and their possible diagnostic and predictive implications as novel biomarkers</article-title>.
          <source>Dis Markers</source>.
          <year>2015</year>;<volume>2015</volume>(<issue>1</issue>):<fpage>253519</fpage>.
        </mixed-citation>
      </ref>
      <ref id="R28">
        <label>28</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Georgiou</surname><given-names>GP</given-names></name>
            <name><surname>Provatopoulou</surname><given-names>X</given-names></name>
            <name><surname>Kalogera</surname><given-names>E</given-names></name>
            <etal/>
          </person-group>.
          <article-title>Serum resistin is inversely related to breast cancer risk in premenopausal women</article-title>.
          <source>The Breast</source>.
          <year>2016</year>;<volume>29</volume>:<fpage>163</fpage>-<lpage>169</lpage>.
        </mixed-citation>
      </ref>
      <ref id="R29">
        <label>29</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Deb</surname><given-names>A</given-names></name>
            <name><surname>Deshmukh</surname><given-names>B</given-names></name>
            <name><surname>Ramteke</surname><given-names>P</given-names></name>
            <name><surname>Bhati</surname><given-names>FK</given-names></name>
            <name><surname>Bhat</surname><given-names>MK</given-names></name>
          </person-group>.
          <article-title>Resistin: A journey from metabolism to cancer</article-title>.
          <source>Transl Oncol</source>.
          <year>2021</year>;<volume>14</volume>(<issue>10</issue>):<fpage>101178</fpage>.
        </mixed-citation>
      </ref>
      <ref id="R30">
        <label>30</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Hlavna</surname><given-names>M</given-names></name>
            <name><surname>Koh&#x00FA;t</surname><given-names>L</given-names></name>
            <name><surname>Lipkov&#x00E1;</surname><given-names>J</given-names></name>
            <etal/>
          </person-group>.
          <article-title>Relationship of resistin levels with endometrial cancer risk</article-title>.
          <source>Neoplasma</source>.
          <year>2011</year>;<volume>58</volume>(<issue>2</issue>):<fpage>124</fpage>-<lpage>128</lpage>.
        </mixed-citation>
      </ref>
      <ref id="R31">
        <label>31</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Liu</surname><given-names>W</given-names></name>
            <name><surname>Li</surname><given-names>M</given-names></name>
            <name><surname>Chen</surname><given-names>X</given-names></name>
            <etal/>
          </person-group>.
          <article-title>MicroRNA-373 promotes migration and invasion in human esophageal squamous cell carcinoma by inhibiting TIMP3 expression</article-title>.
          <source>Am J Cancer Res</source>.
          <year>2015</year>;<volume>6</volume>(<issue>1</issue>):<fpage>1</fpage>.
        </mixed-citation>
      </ref>
      <ref id="R32">
        <label>32</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Tu</surname><given-names>H</given-names></name>
            <name><surname>Chang</surname><given-names>K</given-names></name>
            <name><surname>Cheng</surname><given-names>H</given-names></name>
            <name><surname>Liu</surname><given-names>C</given-names></name>
          </person-group>.
          <article-title>Upregulation of mi R&#x2010;372 and&#x2010;373 associates with lymph node metastasis and poor prognosis of oral carcinomas</article-title>.
          <source>Laryngoscope</source>.
          <year>2015</year>;<volume>125</volume>(<issue>11</issue>):<fpage>E365</fpage>-<lpage>E370</lpage>.
        </mixed-citation>
      </ref>
      <ref id="R33">
        <label>33</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Wei</surname><given-names>F</given-names></name>
            <name><surname>Cao</surname><given-names>C</given-names></name>
            <name><surname>Xu</surname><given-names>X</given-names></name>
            <name><surname>Wang</surname><given-names>J</given-names></name>
          </person-group>.
          <article-title>Diverse functions of miR-373 in cancer</article-title>.
          <source>J Transl Med</source>.
          <year>2015</year>;<volume>13</volume>:<fpage>1</fpage>-<lpage>8</lpage>.
        </mixed-citation>
      </ref>
      <ref id="R34">
        <label>34</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Bakr</surname><given-names>NM</given-names></name>
            <name><surname>Mahmoud</surname><given-names>MS</given-names></name>
            <name><surname>Nabil</surname><given-names>R</given-names></name>
            <name><surname>Boushnak</surname><given-names>H</given-names></name>
            <name><surname>Swellam</surname><given-names>M</given-names></name>
          </person-group>.
          <article-title>Impact of circulating miRNA-373 on breast cancer diagnosis through targeting VEGF and cyclin D1 genes</article-title>.
          <source>J Genet Eng Biotechnol</source>.
          <year>2021</year>;<volume>19</volume>(<issue>1</issue>):<fpage>84</fpage>.
        </mixed-citation>
      </ref>
      <ref id="R35">
        <label>35</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Huang</surname><given-names>Q</given-names></name>
            <name><surname>Gumireddy</surname><given-names>K</given-names></name>
            <name><surname>Schrier</surname><given-names>M</given-names></name>
            <etal/>
          </person-group>.
          <article-title>The microRNAs miR-373 and miR-520c promote tumour invasion and metastasis</article-title>.
          <source>Nat Cell Biol</source>.
          <year>2008</year>;<volume>10</volume>(<issue>2</issue>):<fpage>202</fpage>-<lpage>210</lpage>.
        </mixed-citation>
      </ref>
      <ref id="R36">
        <label>36</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Tavazoie</surname><given-names>SF</given-names></name>
            <name><surname>Alarc&#x00F3;n</surname><given-names>C</given-names></name>
            <name><surname>Oskarsson</surname><given-names>T</given-names></name>
            <etal/>
          </person-group>.
          <article-title>Endogenous human microRNAs that suppress breast cancer metastasis</article-title>.
          <source>Nature</source>.
          <year>2008</year>;<volume>451</volume>(<issue>7175</issue>):<fpage>147</fpage>-<lpage>152</lpage>.
        </mixed-citation>
      </ref>
      <ref id="R37">
        <label>37</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Xiao</surname><given-names>S</given-names></name>
            <name><surname>Zhu</surname><given-names>H</given-names></name>
            <name><surname>Luo</surname><given-names>J</given-names></name>
            <name><surname>Wu</surname><given-names>Z</given-names></name>
            <name><surname>Xie</surname><given-names>M</given-names></name>
          </person-group>.
          <article-title>miR&#x2011;425&#x2011;5p is associated with poor prognosis in patients with breast cancer and promotes cancer cell progression by targeting PTEN</article-title>.
          <source>Oncol Rep</source>.
          <year>2019</year>;<volume>42</volume>(<issue>6</issue>):<fpage>2550</fpage>-<lpage>2560</lpage>.
        </mixed-citation>
      </ref>
      <ref id="R38">
        <label>38</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Zhang</surname><given-names>L</given-names></name>
            <name><surname>Zhang</surname><given-names>J</given-names></name>
            <name><surname>Zhou</surname><given-names>H</given-names></name>
            <etal/>
          </person-group>.
          <article-title>MicroRNA&#x2010;425&#x2010;5p promotes breast cancer cell growth by inducing PI3K/AKT signaling</article-title>.
          <source>Kaohsiung J Med Sci</source>.
          <year>2020</year>;<volume>36</volume>(<issue>4</issue>):<fpage>250</fpage>-<lpage>256</lpage>.
        </mixed-citation>
      </ref>
      <ref id="R39">
        <label>39</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Raheem</surname><given-names>AR</given-names></name>
            <name><surname>Abdul-Rasheed</surname><given-names>OF</given-names></name>
            <name><surname>Khattab</surname><given-names>OS</given-names></name>
            <name><surname>Alsammarraie</surname><given-names>AZ</given-names></name>
            <name><surname>Al-Aubaidy</surname><given-names>H</given-names></name>
            <name><surname>Abid</surname><given-names>HA</given-names></name>
          </person-group>.
          <article-title>Circulating miRNA-373 and Vascular Endothelial Growth Factor as Potential Biomarkers for Early Detection of Breast Cancer</article-title>.
          <source>Indian J Clin Biochem</source>. Published online <year>2024</year>:<fpage>1</fpage>-<lpage>10</lpage>.
        </mixed-citation>
      </ref>
    </ref-list>
  </back>
</article>